Incidental Mutation 'R6646:Skint5'
ID527971
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113940777 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 203 (K203I)
Ref Sequence ENSEMBL: ENSMUSP00000129582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105] [ENSMUST00000171627]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153413
Predicted Effect possibly damaging
Transcript: ENSMUST00000169631
AA Change: K203I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598
AA Change: K203I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170105
AA Change: K203I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598
AA Change: K203I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171627
AA Change: K189I

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130639
Gene: ENSMUSG00000078598
AA Change: K189I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.48e-8 SMART
Pfam:C2-set_2 147 225 3.1e-6 PFAM
internal_repeat_1 268 354 1.61e-12 PROSPERO
low complexity region 356 368 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
internal_repeat_1 415 501 1.61e-12 PROSPERO
low complexity region 506 515 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
PIT4377001:Skint5 UTSW 4 113597703 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2406:Skint5 UTSW 4 113942667 missense probably damaging 0.97
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3816:Skint5 UTSW 4 113629122 splice site probably benign
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5070:Skint5 UTSW 4 113795538 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6370:Skint5 UTSW 4 113614110 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense unknown
R7142:Skint5 UTSW 4 113571594 missense unknown
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTTTAGAAACCAAGTCAAGATGG -3'
(R):5'- GAGCATTTGTTAGTCTACCATGTCC -3'

Sequencing Primer
(F):5'- TAGCAAGTATGTGTGAGAGTGGC -3'
(R):5'- CCTCTTCCATGTGTACCTAACATTAG -3'
Posted On2018-07-24