Incidental Mutation 'R6646:Aldh1a7'
ID527994
Institutional Source Beutler Lab
Gene Symbol Aldh1a7
Ensembl Gene ENSMUSG00000024747
Gene Namealdehyde dehydrogenase family 1, subfamily A7
SynonymsAldh-pb, Ahd2-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location20692953-20727562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20699911 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 449 (A449T)
Ref Sequence ENSEMBL: ENSMUSP00000025656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025656]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025656
AA Change: A449T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025656
Gene: ENSMUSG00000024747
AA Change: A449T

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 2.5e-185 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Lrrn2 C T 1: 132,939,056 P620S probably benign Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Aldh1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Aldh1a7 APN 19 20700046 missense probably damaging 1.00
IGL01132:Aldh1a7 APN 19 20727040 missense possibly damaging 0.76
IGL01630:Aldh1a7 APN 19 20696329 splice site probably benign
IGL01901:Aldh1a7 APN 19 20717739 missense probably damaging 0.99
IGL02324:Aldh1a7 APN 19 20727004 missense probably damaging 1.00
IGL02822:Aldh1a7 APN 19 20702266 missense possibly damaging 0.85
IGL03162:Aldh1a7 APN 19 20708281 missense probably benign 0.21
PIT4514001:Aldh1a7 UTSW 19 20702240 missense probably benign 0.07
R0125:Aldh1a7 UTSW 19 20727066 splice site probably benign
R0268:Aldh1a7 UTSW 19 20709502 critical splice acceptor site probably null
R0833:Aldh1a7 UTSW 19 20702243 missense probably damaging 1.00
R1665:Aldh1a7 UTSW 19 20727461 missense probably benign
R1709:Aldh1a7 UTSW 19 20715952 missense probably damaging 1.00
R1772:Aldh1a7 UTSW 19 20716019 missense probably damaging 1.00
R1917:Aldh1a7 UTSW 19 20727455 missense probably benign
R2570:Aldh1a7 UTSW 19 20699956 missense probably benign 0.35
R3778:Aldh1a7 UTSW 19 20719311 missense possibly damaging 0.70
R3832:Aldh1a7 UTSW 19 20708238 missense probably damaging 1.00
R3894:Aldh1a7 UTSW 19 20696398 nonsense probably null
R4601:Aldh1a7 UTSW 19 20715979 missense probably damaging 0.98
R4948:Aldh1a7 UTSW 19 20727010 missense possibly damaging 0.77
R5562:Aldh1a7 UTSW 19 20702264 nonsense probably null
R5606:Aldh1a7 UTSW 19 20722367 missense probably damaging 1.00
R5641:Aldh1a7 UTSW 19 20715929 missense probably benign 0.00
R5808:Aldh1a7 UTSW 19 20708197 missense possibly damaging 0.79
R6759:Aldh1a7 UTSW 19 20699956 missense possibly damaging 0.89
R7034:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7036:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7150:Aldh1a7 UTSW 19 20716018 missense probably damaging 1.00
R7255:Aldh1a7 UTSW 19 20714728 missense probably damaging 1.00
X0022:Aldh1a7 UTSW 19 20719315 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGAGTAATTTGAAAAGCTGCCTG -3'
(R):5'- CCAATGAAGAATGGTTTCTAGGCAAAC -3'

Sequencing Primer
(F):5'- AGCTGCCTGATAATAATGTCTTTTGG -3'
(R):5'- TGGTTTCTAGGCAAACATATGTAC -3'
Posted On2018-07-24