Incidental Mutation 'R6662:Garem1'
ID528039
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene NameGRB2 associated regulator of MAPK1 subtype 1
SynonymsGarem, Fam59a, LOC381126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6662 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location21127201-21300138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21148247 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 351 (N351D)
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
Predicted Effect probably benign
Transcript: ENSMUST00000049260
AA Change: N351D

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: N351D

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,073,853 probably null Het
Acox1 A G 11: 116,175,323 Y418H probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Aldh3a1 G A 11: 61,214,655 V196I probably benign Het
Aox3 A G 1: 58,118,615 K44E probably damaging Het
Bad T A 19: 6,951,070 probably benign Het
BC034090 G T 1: 155,226,339 Q60K possibly damaging Het
Casp6 A G 3: 129,912,226 T181A probably benign Het
Catsperg2 G A 7: 29,719,513 probably benign Het
Ccdc14 T C 16: 34,690,794 L46P probably damaging Het
Ces1b A G 8: 93,064,069 L364S probably benign Het
Cfap45 T C 1: 172,529,850 I15T probably benign Het
D730048I06Rik C A 9: 35,790,000 R6M possibly damaging Het
Dph5 G A 3: 115,928,556 E228K probably benign Het
Fat4 G T 3: 38,956,821 L2023F possibly damaging Het
Gm14124 G A 2: 150,266,252 probably null Het
Grm2 C T 9: 106,648,053 A488T probably benign Het
Ifit3b A G 19: 34,611,937 E171G probably damaging Het
Il1rn A T 2: 24,336,875 probably null Het
Itih5 A T 2: 10,249,181 I748F probably benign Het
Kcnh5 C A 12: 75,007,611 D520Y probably damaging Het
Mgat5 C A 1: 127,469,237 H574N probably damaging Het
Moxd1 A C 10: 24,284,760 D437A probably damaging Het
Mybpc2 A G 7: 44,506,166 F888L probably benign Het
Ncs1 T A 2: 31,287,360 L183Q probably damaging Het
Neto2 A T 8: 85,663,215 D206E probably damaging Het
Omp A G 7: 98,145,339 L27P probably damaging Het
Oxsm A G 14: 16,242,287 S161P probably benign Het
Pde4b A G 4: 102,601,898 I381M possibly damaging Het
Pramel5 A T 4: 144,273,105 N137K probably benign Het
Prss33 T C 17: 23,833,960 S247G probably damaging Het
Rassf9 T A 10: 102,546,038 L425Q possibly damaging Het
Setx A T 2: 29,158,114 D1909V probably damaging Het
Slc26a3 A T 12: 31,457,346 K402* probably null Het
Slco1a6 G A 6: 142,133,215 T118I probably damaging Het
Syne1 A G 10: 5,128,416 L6769P probably damaging Het
Tas2r107 A T 6: 131,659,489 V199D possibly damaging Het
Tchp A G 5: 114,720,015 probably null Het
Trdn A T 10: 33,474,487 N684I probably damaging Het
Trio G T 15: 27,854,996 T700K probably benign Het
Ttn C T 2: 76,755,898 V20084I probably benign Het
Ubl3 A T 5: 148,509,306 Y62* probably null Het
Uckl1 A G 2: 181,573,260 Y267H possibly damaging Het
Zfp786 T C 6: 47,826,986 N41D probably damaging Het
Zfp983 T C 17: 21,662,085 S310P probably damaging Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21148657 missense probably damaging 1.00
IGL01588:Garem1 APN 18 21129797 missense probably damaging 0.99
IGL02171:Garem1 APN 18 21129241 missense probably damaging 0.98
IGL02270:Garem1 APN 18 21148450 missense probably damaging 1.00
IGL03149:Garem1 APN 18 21131466 missense probably damaging 1.00
R0136:Garem1 UTSW 18 21129991 missense probably damaging 0.96
R0285:Garem1 UTSW 18 21129612 missense probably benign
R0361:Garem1 UTSW 18 21299744 nonsense probably null
R1068:Garem1 UTSW 18 21168755 missense probably benign 0.00
R1537:Garem1 UTSW 18 21168874 splice site probably null
R1726:Garem1 UTSW 18 21148262 missense probably damaging 0.99
R1826:Garem1 UTSW 18 21129452 missense probably benign 0.00
R2140:Garem1 UTSW 18 21129374 missense probably damaging 1.00
R3714:Garem1 UTSW 18 21148890 missense probably damaging 1.00
R3937:Garem1 UTSW 18 21148806 nonsense probably null
R4362:Garem1 UTSW 18 21236115 missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21168750 missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21129943 missense probably benign
R4814:Garem1 UTSW 18 21148116 missense probably damaging 1.00
R4831:Garem1 UTSW 18 21129768 missense probably benign 0.01
R4838:Garem1 UTSW 18 21147893 missense probably benign 0.00
R5805:Garem1 UTSW 18 21148435 missense probably benign 0.04
R5963:Garem1 UTSW 18 21129430 missense probably benign 0.45
R5982:Garem1 UTSW 18 21148351 missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21129824 missense probably benign 0.00
R6242:Garem1 UTSW 18 21129172 missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6485:Garem1 UTSW 18 21129837 missense probably benign 0.00
R6596:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6885:Garem1 UTSW 18 21129712 missense probably benign
R6937:Garem1 UTSW 18 21147770 missense probably benign 0.00
R7027:Garem1 UTSW 18 21129994 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGCCATGGAGATTCACC -3'
(R):5'- AAGTTTGTGAACATCCAGACCAAG -3'

Sequencing Primer
(F):5'- AGATTCACCTCACTATTGCCATGGAG -3'
(R):5'- TTGTGTGCTGCGCAACAAC -3'
Posted On2018-07-24