Incidental Mutation 'R6669:Nlk'
ID528066
Institutional Source Beutler Lab
Gene Symbol Nlk
Ensembl Gene ENSMUSG00000017376
Gene Namenemo like kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6669 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78567168-78697373 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 78587066 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 284 (G284*)
Ref Sequence ENSEMBL: ENSMUSP00000119345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142739]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119052
Predicted Effect probably null
Transcript: ENSMUST00000142739
AA Change: G284*
SMART Domains Protein: ENSMUSP00000119345
Gene: ENSMUSG00000017376
AA Change: G284*

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 27 55 N/A INTRINSIC
low complexity region 97 119 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
S_TKc 138 427 3.36e-89 SMART
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation die either during late gestation or around 4-6 weeks, depending on background. Long survivors exhibit growth retardation, neurological abnormalities, and aberrant differentiation of bone marrow stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Ntn1 T C 11: 68,385,750 N124S probably benign Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Nlk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Nlk APN 11 78589375 missense probably damaging 1.00
IGL02186:Nlk APN 11 78586936 missense probably damaging 1.00
IGL02336:Nlk APN 11 78586937 missense probably damaging 1.00
IGL02739:Nlk APN 11 78574851 missense probably benign 0.05
IGL02953:Nlk APN 11 78626701 missense probably benign 0.02
Verne UTSW 11 78587066 nonsense probably null
R0276:Nlk UTSW 11 78571475 missense probably benign 0.01
R0324:Nlk UTSW 11 78572431 missense possibly damaging 0.71
R0636:Nlk UTSW 11 78695844 missense probably benign 0.34
R0639:Nlk UTSW 11 78572277 missense possibly damaging 0.86
R1776:Nlk UTSW 11 78587027 missense probably benign 0.03
R1886:Nlk UTSW 11 78586928 missense probably damaging 1.00
R4330:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R4331:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R5974:Nlk UTSW 11 78590966 missense probably benign 0.39
R6532:Nlk UTSW 11 78696055 missense probably damaging 0.99
R6873:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R7165:Nlk UTSW 11 78590967 nonsense probably null
R7475:Nlk UTSW 11 78583399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACACCTGCTGAATGGG -3'
(R):5'- CAAACACTGGGCATGGCATG -3'

Sequencing Primer
(F):5'- TGCGCCTGAAACAATATTCTTCGG -3'
(R):5'- GGGCATGGCATGGTGGC -3'
Posted On2018-07-24