Incidental Mutation 'R6652:Olfr1507'
ID528111
Institutional Source Beutler Lab
Gene Symbol Olfr1507
Ensembl Gene ENSMUSG00000059887
Gene Nameolfactory receptor 1507
SynonymsMOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.014) question?
Stock #R6652 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52488791-52495749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52490793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 57 (R57Q)
Ref Sequence ENSEMBL: ENSMUSP00000146152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073571] [ENSMUST00000205963] [ENSMUST00000206062] [ENSMUST00000206069] [ENSMUST00000206931]
Predicted Effect probably benign
Transcript: ENSMUST00000073571
AA Change: R57Q

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073260
Gene: ENSMUSG00000059887
AA Change: R57Q

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 305 3.6e-9 PFAM
Pfam:7tm_1 44 290 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205963
AA Change: R30Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000206062
AA Change: R57Q

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206069
Predicted Effect probably benign
Transcript: ENSMUST00000206931
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,246,941 D605G probably damaging Het
Cfh A T 1: 140,144,068 I294N probably benign Het
Clk3 A G 9: 57,761,795 S49P probably damaging Het
Cmya5 A G 13: 93,092,895 V1895A probably benign Het
Cmya5 T C 13: 93,093,039 D1847G probably damaging Het
Cwf19l1 T C 19: 44,114,699 D359G probably benign Het
Dag1 A T 9: 108,209,090 M284K probably damaging Het
Ergic2 T C 6: 148,189,581 Y211C probably damaging Het
Espnl A C 1: 91,344,699 I594L probably benign Het
Fam193b A G 13: 55,542,790 S226P probably damaging Het
Fat2 T A 11: 55,252,262 I4254L probably benign Het
Fhdc1 T C 3: 84,464,324 Y108C probably damaging Het
Fut9 G C 4: 25,620,619 T65S probably benign Het
Gm9507 A T 10: 77,811,659 probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grap2 A T 15: 80,648,522 N297Y probably damaging Het
Igfn1 A G 1: 135,963,871 F2302S probably damaging Het
Ighv1-81 T A 12: 115,920,431 I67F probably damaging Het
Kidins220 T A 12: 25,010,060 probably null Het
Kti12 T A 4: 108,848,533 S215T probably benign Het
Mc1r G A 8: 123,407,631 G41D probably damaging Het
Mov10l1 A G 15: 88,993,902 Y129C probably damaging Het
Mthfsd A T 8: 121,098,821 L337Q probably damaging Het
Musk C T 4: 58,368,977 A629V probably damaging Het
Nadsyn1 A T 7: 143,811,218 M250K probably benign Het
Ncapd2 G A 6: 125,186,270 H92Y probably benign Het
Olfr220 G A 1: 174,449,061 C146Y probably damaging Het
Plec A T 15: 76,179,774 V2100E probably damaging Het
Prss37 C A 6: 40,519,156 probably benign Het
Sebox A T 11: 78,503,805 E32V probably damaging Het
Senp7 C A 16: 56,123,894 Q194K probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Spg20 G A 3: 55,124,827 E361K probably benign Het
Stn1 T C 19: 47,507,578 T334A probably benign Het
Stoml1 A G 9: 58,256,734 D112G probably damaging Het
Thap2 T A 10: 115,376,536 D28V probably damaging Het
Ubap2 A T 4: 41,196,743 N872K possibly damaging Het
Vezt A G 10: 93,970,279 F757L probably damaging Het
Vmn1r204 T C 13: 22,556,403 I68T probably damaging Het
Wnt10a A G 1: 74,803,454 probably null Het
Yipf7 A G 5: 69,541,161 M1T probably null Het
Zdhhc19 T C 16: 32,497,229 F48S probably damaging Het
Zfp317 C T 9: 19,647,039 T183I probably damaging Het
Other mutations in Olfr1507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr1507 APN 14 52490748 missense probably damaging 1.00
IGL01367:Olfr1507 APN 14 52490167 missense probably benign 0.42
IGL01664:Olfr1507 APN 14 52490545 missense probably benign 0.01
IGL02890:Olfr1507 APN 14 52490911 missense probably benign
IGL03108:Olfr1507 APN 14 52490076 missense probably damaging 0.97
IGL03184:Olfr1507 APN 14 52490923 missense probably benign 0.20
R0563:Olfr1507 UTSW 14 52490257 nonsense probably null
R1080:Olfr1507 UTSW 14 52490585 nonsense probably null
R1558:Olfr1507 UTSW 14 52490146 missense probably benign 0.26
R1653:Olfr1507 UTSW 14 52490772 missense probably damaging 1.00
R1714:Olfr1507 UTSW 14 52490414 unclassified probably null
R1720:Olfr1507 UTSW 14 52490594 nonsense probably null
R3430:Olfr1507 UTSW 14 52490425 missense possibly damaging 0.92
R4995:Olfr1507 UTSW 14 52490531 nonsense probably null
R5954:Olfr1507 UTSW 14 52490167 missense probably benign 0.42
R6183:Olfr1507 UTSW 14 52490731 missense probably benign 0.05
R6518:Olfr1507 UTSW 14 52490620 missense probably damaging 1.00
R6651:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6653:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
X0025:Olfr1507 UTSW 14 52490466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAAAGGTTTACAAATGGCCAC -3'
(R):5'- TGGAAAAGGCTGTCCTCATC -3'

Sequencing Primer
(F):5'- GGTTTACAAATGGCCACATAGCGATC -3'
(R):5'- TCATCAACCAAACTTCAGTGATGTC -3'
Posted On2018-07-24