Incidental Mutation 'R6620:Dock10'
ID528120
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R6620 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80592638 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 361 (N361I)
Ref Sequence ENSEMBL: ENSMUSP00000140513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000186087] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983] [ENSMUST00000191449]
Predicted Effect probably benign
Transcript: ENSMUST00000077946
AA Change: N379I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: N379I

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186087
AA Change: N392I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140102
Gene: ENSMUSG00000038608
AA Change: N392I

DomainStartEndE-ValueType
Pfam:DUF3398 71 166 1.5e-29 PFAM
PH 195 305 3.9e-19 SMART
Blast:PH 363 475 3e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187774
AA Change: N367I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: N367I

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190595
AA Change: N32I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: N32I

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
AA Change: N366I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: N366I

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191449
AA Change: N361I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140513
Gene: ENSMUSG00000038608
AA Change: N361I

DomainStartEndE-ValueType
Pfam:DUF3398 40 135 1.1e-32 PFAM
PH 164 274 8.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191505
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G T 3: 36,066,145 A13S possibly damaging Het
Ahnak G A 19: 9,015,310 E4653K possibly damaging Het
Apc2 C T 10: 80,313,567 P1485L probably damaging Het
Atp9b A T 18: 80,808,687 L397* probably null Het
Ces1e C A 8: 93,223,918 K79N probably damaging Het
Col12a1 A C 9: 79,620,049 I2666M probably damaging Het
Dock3 C A 9: 106,937,926 M1247I probably benign Het
Evi5l C A 8: 4,206,674 A720E possibly damaging Het
F5 T C 1: 164,186,806 F549L probably damaging Het
Gpx2 T C 12: 76,792,900 N108S possibly damaging Het
Ifnar1 T C 16: 91,496,267 probably null Het
Kcnj16 T C 11: 111,024,647 V45A probably damaging Het
Kng1 T C 16: 23,081,482 L402P possibly damaging Het
Lct C A 1: 128,295,072 probably null Het
Lmo7 G T 14: 101,875,452 K106N probably benign Het
Map3k13 A T 16: 21,892,311 I115F possibly damaging Het
Mapre2 T C 18: 23,857,945 V123A probably benign Het
Mtfr1l A G 4: 134,529,083 probably null Het
Olfr1185-ps1 A G 2: 88,526,399 Y272C probably damaging Het
Olfr981 T A 9: 40,022,929 C179S probably damaging Het
Pbxip1 G A 3: 89,447,826 V551I probably benign Het
Pcdha8 T C 18: 36,992,528 I21T probably benign Het
Plekha5 G A 6: 140,572,875 R296Q probably damaging Het
Psme2 A C 14: 55,588,471 D126E probably damaging Het
Psmg2 T C 18: 67,641,737 probably null Het
Ranbp2 A T 10: 58,455,807 probably null Het
Sdr39u1 C T 14: 55,897,715 R257H probably damaging Het
Sorbs2 G T 8: 45,796,176 R802S probably damaging Het
Spata31 A G 13: 64,919,757 N78D possibly damaging Het
Spatc1l A G 10: 76,569,922 D320G probably damaging Het
Ttc8 T C 12: 98,957,320 Y212H possibly damaging Het
Vmn2r112 G A 17: 22,603,101 M253I probably benign Het
Zbed5 A G 5: 129,903,289 E693G possibly damaging Het
Zfp808 T A 13: 62,172,824 N622K probably benign Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCTAGATCCTGAGGTTAGC -3'
(R):5'- CGAAACATGGGCAGACTCAATC -3'

Sequencing Primer
(F):5'- TCCTGAGGTTAGCAAGCATAG -3'
(R):5'- AGACTCAATCTGTTCTCCCTGGAC -3'
Posted On2018-07-24