Mutagenetix > Incidental Mutation

Incidental Mutation 'R6620:Psme2'

528143

Institutional Source

Beutler Lab

Gene Symbol

Psme2

Ensembl Gene

ENSMUSG00000079197

Gene Name

proteasome (prosome, macropain) activator subunit 2 (PA28 beta)

Synonyms

PA28b

MMRRC Submission

044743-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R6620 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55824897-55828558 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 55825928 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 126 (D126E)

Ref Sequence

ENSEMBL: ENSMUSP00000125596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000022828] [ENSMUST00000111378] [ENSMUST00000137296] [ENSMUST00000161807] [ENSMUST00000159687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000019443

SMART Domains

Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	68	148	7.1e-17	PFAM
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	405	429	4.86e-1	SMART
Pfam:HOIP-UBA	477	622	2.4e-54	PFAM
Blast:RING	693	741	7e-25	BLAST
IBR	773	835	3.18e-14	SMART
IBR	847	924	5.35e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000022828

SMART Domains

Protein: ENSMUSP00000022828
Gene: ENSMUSG00000022217

Domain	Start	End	E-Value	Type
Pfam:UPF0172	3	191	1.9e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111378
AA Change: D126E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107009
Gene: ENSMUSG00000079197
AA Change: D126E

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	1	64	2.2e-26	PFAM
Pfam:PA28_beta	82	231	1.7e-66	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126544

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137296

SMART Domains

Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
low complexity region	10	21	N/A	INTRINSIC
Pfam:PUB	66	151	6.8e-17	PFAM
Blast:RING	214	257	3e-17	BLAST
low complexity region	262	294	N/A	INTRINSIC
ZnF_RBZ	298	322	2.56e-1	SMART
ZnF_RBZ	346	370	6.93e-5	SMART
ZnF_RBZ	404	428	4.86e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140178

SMART Domains

Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098

Domain	Start	End	E-Value	Type
PDB:4OYJ\|M	2	85	1e-29	PDB
low complexity region	164	196	N/A	INTRINSIC
ZnF_RBZ	200	224	2.56e-1	SMART
ZnF_RBZ	248	272	6.93e-5	SMART
ZnF_RBZ	307	331	4.86e-1	SMART
Pfam:HOIP-UBA	369	468	1.1e-31	PFAM
Blast:RING	539	587	9e-25	BLAST
IBR	619	681	3.18e-14	SMART
IBR	693	770	5.35e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161807
AA Change: D134E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123798
Gene: ENSMUSG00000079197
AA Change: D134E

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	11	71	1.2e-26	PFAM
Pfam:PA28_beta	93	237	5.3e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159687
AA Change: D126E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125596
Gene: ENSMUSG00000079197
AA Change: D126E

Domain	Start	End	E-Value	Type
Pfam:PA28_alpha	1	64	1.2e-26	PFAM
Pfam:PA28_beta	82	165	3e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174618

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159282

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162700

Predicted Effect

probably benign
Transcript: ENSMUST00000174352

SMART Domains

Protein: ENSMUSP00000133463
Gene: ENSMUSG00000022217

Domain	Start	End	E-Value	Type
Pfam:UPF0172	1	43	6.3e-11	PFAM
Pfam:UPF0172	41	82	1.2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162496

Meta Mutation Damage Score

0.6796

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring. Six pseudogenes have been identified on chromosomes 4, 5, 8, 10 and 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in impaired cytotoxic T lymphocyte responses and immunoproteasome assembly. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	G	T	3: 36,120,294 (GRCm39)	A13S	possibly damaging	Het
Ahnak	G	A	19: 8,992,674 (GRCm39)	E4653K	possibly damaging	Het
Apc2	C	T	10: 80,149,401 (GRCm39)	P1485L	probably damaging	Het
Atp9b	A	T	18: 80,851,902 (GRCm39)	L397*	probably null	Het
Ces1e	C	A	8: 93,950,546 (GRCm39)	K79N	probably damaging	Het
Col12a1	A	C	9: 79,527,331 (GRCm39)	I2666M	probably damaging	Het
Dock10	T	A	1: 80,570,355 (GRCm39)	N361I	probably benign	Het
Dock3	C	A	9: 106,815,125 (GRCm39)	M1247I	probably benign	Het
Evi5l	C	A	8: 4,256,674 (GRCm39)	A720E	possibly damaging	Het
F5	T	C	1: 164,014,375 (GRCm39)	F549L	probably damaging	Het
Gpx2	T	C	12: 76,839,674 (GRCm39)	N108S	possibly damaging	Het
Ifnar1	T	C	16: 91,293,155 (GRCm39)		probably null	Het
Kcnj16	T	C	11: 110,915,473 (GRCm39)	V45A	probably damaging	Het
Kng1	T	C	16: 22,900,232 (GRCm39)	L402P	possibly damaging	Het
Lct	C	A	1: 128,222,809 (GRCm39)		probably null	Het
Lmo7	G	T	14: 102,112,888 (GRCm39)	K106N	probably benign	Het
Map3k13	A	T	16: 21,711,061 (GRCm39)	I115F	possibly damaging	Het
Mapre2	T	C	18: 23,991,002 (GRCm39)	V123A	probably benign	Het
Mtfr1l	A	G	4: 134,256,394 (GRCm39)		probably null	Het
Or10g6	T	A	9: 39,934,225 (GRCm39)	C179S	probably damaging	Het
Or4c99	A	G	2: 88,356,743 (GRCm39)	Y272C	probably damaging	Het
Pbxip1	G	A	3: 89,355,133 (GRCm39)	V551I	probably benign	Het
Pcdha8	T	C	18: 37,125,581 (GRCm39)	I21T	probably benign	Het
Plekha5	G	A	6: 140,518,601 (GRCm39)	R296Q	probably damaging	Het
Psmg2	T	C	18: 67,774,807 (GRCm39)		probably null	Het
Ranbp2	A	T	10: 58,291,629 (GRCm39)		probably null	Het
Sdr39u1	C	T	14: 56,135,172 (GRCm39)	R257H	probably damaging	Het
Sorbs2	G	T	8: 46,249,213 (GRCm39)	R802S	probably damaging	Het
Spata31	A	G	13: 65,067,571 (GRCm39)	N78D	possibly damaging	Het
Spatc1l	A	G	10: 76,405,756 (GRCm39)	D320G	probably damaging	Het
Ttc8	T	C	12: 98,923,579 (GRCm39)	Y212H	possibly damaging	Het
Vmn2r112	G	A	17: 22,822,082 (GRCm39)	M253I	probably benign	Het
Zbed5	A	G	5: 129,932,130 (GRCm39)	E693G	possibly damaging	Het
Zfp808	T	A	13: 62,320,638 (GRCm39)	N622K	probably benign	Het

Other mutations in Psme2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Psme2	APN	14	55,825,893 (GRCm39)	unclassified	probably benign
IGL01462:Psme2	APN	14	55,827,128 (GRCm39)	missense	probably damaging	1.00
R1853:Psme2	UTSW	14	55,825,936 (GRCm39)	missense	probably damaging	1.00
R2103:Psme2	UTSW	14	55,828,297 (GRCm39)	critical splice donor site	probably null
R4093:Psme2	UTSW	14	55,825,734 (GRCm39)	missense	probably benign	0.01
R5999:Psme2	UTSW	14	55,827,539 (GRCm39)	missense	probably damaging	1.00
R6010:Psme2	UTSW	14	55,824,980 (GRCm39)	splice site	probably null
R7106:Psme2	UTSW	14	55,825,694 (GRCm39)	missense	probably benign	0.02
R8679:Psme2	UTSW	14	55,827,074 (GRCm39)	critical splice donor site	probably null
R9123:Psme2	UTSW	14	55,828,302 (GRCm39)	missense	possibly damaging	0.94
R9125:Psme2	UTSW	14	55,828,302 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCCTGCAGAGACGTGAGAAG -3'
(R):5'- CATGTGCAGGTAGGTTTTCCATTTC -3'

Sequencing Primer
(F):5'- TGAGAAGCAAAGACAACAGTTCATC -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'

Posted On

2018-07-24