Incidental Mutation 'R6700:Baiap3'
ID528243
Institutional Source Beutler Lab
Gene Symbol Baiap3
Ensembl Gene ENSMUSG00000047507
Gene NameBAI1-associated protein 3
SynonymsLOC381076
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6700 (G1)
Quality Score193.009
Status Validated
Chromosome17
Chromosomal Location25242659-25256364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25244026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1013 (S1013P)
Ref Sequence ENSEMBL: ENSMUSP00000138254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038973] [ENSMUST00000063574] [ENSMUST00000115154] [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]
Predicted Effect probably benign
Transcript: ENSMUST00000038973
SMART Domains Protein: ENSMUSP00000042073
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 152 1.4e-10 PFAM
DMAP_binding 176 278 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063574
SMART Domains Protein: ENSMUSP00000068511
Gene: ENSMUSG00000015126

DomainStartEndE-ValueType
Pfam:RLI 58 92 8.2e-17 PFAM
Pfam:DUF367 96 222 1.3e-56 PFAM
low complexity region 261 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115154
SMART Domains Protein: ENSMUSP00000110807
Gene: ENSMUSG00000035521

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PRKCSH 69 151 3.9e-11 PFAM
DMAP_binding 183 285 2.55e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169109
AA Change: S1026P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: S1026P

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
Pfam:Membr_traf_MHD 896 958 8e-10 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175461
Predicted Effect probably damaging
Transcript: ENSMUST00000182056
AA Change: S1049P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: S1049P

DomainStartEndE-ValueType
C2 159 328 4.73e-17 SMART
low complexity region 361 379 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 497 509 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Pfam:Membr_traf_MHD 851 959 3.3e-30 PFAM
C2 989 1097 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182126
Predicted Effect probably damaging
Transcript: ENSMUST00000182435
AA Change: S1021P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: S1021P

DomainStartEndE-ValueType
C2 131 300 4.73e-17 SMART
low complexity region 333 351 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Membr_traf_MHD 823 931 3.2e-30 PFAM
C2 961 1069 7.06e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182696
Predicted Effect probably damaging
Transcript: ENSMUST00000182825
AA Change: S1013P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: S1013P

DomainStartEndE-ValueType
C2 159 284 4.05e-16 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 461 473 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
Pfam:Membr_traf_MHD 815 923 3.2e-30 PFAM
C2 953 1061 7.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182922
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Fst G C 13: 114,458,507 A27G probably benign Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr427 G A 1: 174,099,839 C127Y probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Strbp T C 2: 37,603,963 D366G probably null Het
Tbx5 A G 5: 119,871,397 T324A probably benign Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Tmtc3 C T 10: 100,471,477 V222I probably benign Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Baiap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Baiap3 APN 17 25244328 missense probably damaging 1.00
IGL00486:Baiap3 APN 17 25248377 splice site probably benign
IGL00820:Baiap3 APN 17 25248690 missense probably benign 0.20
IGL01443:Baiap3 APN 17 25245147 missense possibly damaging 0.92
IGL02282:Baiap3 APN 17 25249377 missense probably benign 0.11
IGL02341:Baiap3 APN 17 25248316 missense possibly damaging 0.52
IGL02669:Baiap3 APN 17 25244348 missense probably damaging 1.00
IGL02863:Baiap3 APN 17 25244502 splice site probably benign
IGL02993:Baiap3 APN 17 25250082 critical splice donor site probably null
R0021:Baiap3 UTSW 17 25243669 missense probably damaging 1.00
R0090:Baiap3 UTSW 17 25250070 splice site probably benign
R0276:Baiap3 UTSW 17 25243687 missense probably damaging 1.00
R0488:Baiap3 UTSW 17 25248470 critical splice donor site probably null
R0826:Baiap3 UTSW 17 25245229 missense possibly damaging 0.89
R0883:Baiap3 UTSW 17 25249101 missense probably damaging 1.00
R1700:Baiap3 UTSW 17 25249328 missense probably damaging 1.00
R1702:Baiap3 UTSW 17 25244805 missense probably damaging 1.00
R2336:Baiap3 UTSW 17 25250404 missense probably damaging 1.00
R2762:Baiap3 UTSW 17 25244575 missense probably damaging 1.00
R4454:Baiap3 UTSW 17 25249536 missense probably damaging 1.00
R4540:Baiap3 UTSW 17 25246670 missense probably damaging 1.00
R4609:Baiap3 UTSW 17 25250261 missense probably damaging 1.00
R4816:Baiap3 UTSW 17 25247295 splice site probably benign
R4979:Baiap3 UTSW 17 25246362 missense possibly damaging 0.57
R5069:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5070:Baiap3 UTSW 17 25249108 missense probably damaging 0.99
R5093:Baiap3 UTSW 17 25250269 missense probably damaging 1.00
R5130:Baiap3 UTSW 17 25245342 missense probably benign 0.01
R5566:Baiap3 UTSW 17 25251733 missense probably damaging 1.00
R5572:Baiap3 UTSW 17 25251475 missense possibly damaging 0.86
R5681:Baiap3 UTSW 17 25249373 missense probably damaging 1.00
R5730:Baiap3 UTSW 17 25247524 missense probably benign 0.01
R5743:Baiap3 UTSW 17 25244785 missense probably benign 0.02
R5805:Baiap3 UTSW 17 25247515 missense probably benign 0.12
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6038:Baiap3 UTSW 17 25246334 missense probably damaging 1.00
R6052:Baiap3 UTSW 17 25248470 critical splice donor site probably benign
R6238:Baiap3 UTSW 17 25245758 missense probably benign 0.00
R7037:Baiap3 UTSW 17 25243840 missense probably benign
R7038:Baiap3 UTSW 17 25243840 missense probably benign
R7039:Baiap3 UTSW 17 25243840 missense probably benign
R7126:Baiap3 UTSW 17 25245145 missense possibly damaging 0.64
X0017:Baiap3 UTSW 17 25248350 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGAGAGTGATAGGCTGACC -3'
(R):5'- CCCAATGTATCTTCTAGGCCTAAG -3'

Sequencing Primer
(F):5'- CTGACCTGGCCTCATGC -3'
(R):5'- TAGGCCTAAGTGACCCGTTC -3'
Posted On2018-07-24