Incidental Mutation 'R6703:Ndor1'
ID528257
Institutional Source Beutler Lab
Gene Symbol Ndor1
Ensembl Gene ENSMUSG00000006471
Gene NameNADPH dependent diflavin oxidoreductase 1
SynonymsNR1, 4930447P04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25244821-25256022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25249890 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 142 (F142S)
Ref Sequence ENSEMBL: ENSMUSP00000097903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100329] [ENSMUST00000114349] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000148589] [ENSMUST00000228052] [ENSMUST00000228627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100329
AA Change: F142S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471
AA Change: F142S

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114349
AA Change: F209S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471
AA Change: F209S

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129705
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect unknown
Transcript: ENSMUST00000141808
AA Change: F174S
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471
AA Change: F174S

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228052
AA Change: F140S

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000228627
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Ndor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Ndor1 APN 2 25250139 missense probably benign 0.05
IGL02174:Ndor1 APN 2 25249194 missense possibly damaging 0.49
IGL02366:Ndor1 APN 2 25247981 missense possibly damaging 0.94
IGL02407:Ndor1 APN 2 25249269 missense probably benign 0.39
IGL02630:Ndor1 APN 2 25255287 missense probably damaging 1.00
R0139:Ndor1 UTSW 2 25248354 missense possibly damaging 0.90
R0194:Ndor1 UTSW 2 25248706 unclassified probably null
R0926:Ndor1 UTSW 2 25248348 missense probably benign 0.08
R1530:Ndor1 UTSW 2 25248909 missense probably benign 0.02
R1533:Ndor1 UTSW 2 25249267 missense probably damaging 0.98
R1837:Ndor1 UTSW 2 25248396 missense probably damaging 1.00
R1954:Ndor1 UTSW 2 25255293 missense possibly damaging 0.86
R1981:Ndor1 UTSW 2 25255224 missense probably damaging 0.97
R2090:Ndor1 UTSW 2 25249218 missense probably damaging 1.00
R2188:Ndor1 UTSW 2 25251753 unclassified probably null
R3433:Ndor1 UTSW 2 25247811 missense possibly damaging 0.91
R3620:Ndor1 UTSW 2 25248035 missense probably damaging 1.00
R4013:Ndor1 UTSW 2 25250150 missense probably damaging 0.98
R4411:Ndor1 UTSW 2 25248480 missense probably benign 0.08
R4457:Ndor1 UTSW 2 25248116 unclassified probably null
R4942:Ndor1 UTSW 2 25248121 critical splice donor site probably null
R5132:Ndor1 UTSW 2 25247769 missense probably benign 0.28
R6476:Ndor1 UTSW 2 25248142 missense possibly damaging 0.95
R6702:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
X0018:Ndor1 UTSW 2 25247844 missense probably benign 0.03
X0019:Ndor1 UTSW 2 25248181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCCCTAACTACTGCCTAC -3'
(R):5'- TGAGATTCCTCATGGAGTCCC -3'

Sequencing Primer
(F):5'- AAGCCCTAACTACTGCCTACCTTTTC -3'
(R):5'- CCTTGGGTATATGAATATCAAGGGAC -3'
Posted On2018-07-24