Incidental Mutation 'R6703:Dpyd'
ID528267
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R6703 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location118562129-119432924 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 118897200 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably null
Transcript: ENSMUST00000039177
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129148
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q93R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ugt1a10 TTCATCA TTCA 1: 88,216,158 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCACAGTACTTTGAAGATTGTCAC -3'
(R):5'- AATGCCTTTCATGATGCATTCTTG -3'

Sequencing Primer
(F):5'- TAGGCTTGCCAGAACCC -3'
(R):5'- TCATGATGCATTCTTGGAATAATAGG -3'
Posted On2018-07-24