Incidental Mutation 'R6703:Lrrc43'
ID528272
Institutional Source Beutler Lab
Gene Symbol Lrrc43
Ensembl Gene ENSMUSG00000063409
Gene Nameleucine rich repeat containing 43
SynonymsLOC381741
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123489305-123508205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123499469 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 233 (T233M)
Ref Sequence ENSEMBL: ENSMUSP00000113933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094327] [ENSMUST00000121444] [ENSMUST00000196809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094327
AA Change: T233M

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091885
Gene: ENSMUSG00000063409
AA Change: T233M

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 3e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121444
AA Change: T233M

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113933
Gene: ENSMUSG00000063409
AA Change: T233M

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 4e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 530 558 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196809
AA Change: T233M

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143602
Gene: ENSMUSG00000063409
AA Change: T233M

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 2e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 635 652 N/A INTRINSIC
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Lrrc43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Lrrc43 APN 5 123494279 missense probably damaging 1.00
IGL02364:Lrrc43 APN 5 123501212 missense possibly damaging 0.77
PIT4520001:Lrrc43 UTSW 5 123492467 missense possibly damaging 0.93
R0019:Lrrc43 UTSW 5 123501315 missense probably damaging 1.00
R0279:Lrrc43 UTSW 5 123497022 splice site probably null
R0523:Lrrc43 UTSW 5 123501242 missense probably damaging 1.00
R1723:Lrrc43 UTSW 5 123492213 unclassified probably benign
R2104:Lrrc43 UTSW 5 123501114 missense probably benign 0.00
R2213:Lrrc43 UTSW 5 123503577 missense possibly damaging 0.94
R2269:Lrrc43 UTSW 5 123503291 missense probably damaging 1.00
R4591:Lrrc43 UTSW 5 123501164 missense probably benign 0.00
R4629:Lrrc43 UTSW 5 123499520 missense probably damaging 1.00
R4727:Lrrc43 UTSW 5 123494303 missense probably damaging 1.00
R4941:Lrrc43 UTSW 5 123501063 missense probably benign 0.01
R4960:Lrrc43 UTSW 5 123499612 missense probably benign 0.19
R5028:Lrrc43 UTSW 5 123508113 missense probably damaging 1.00
R5387:Lrrc43 UTSW 5 123499671 splice site probably null
R5653:Lrrc43 UTSW 5 123499580 missense probably damaging 1.00
R6266:Lrrc43 UTSW 5 123503277 missense probably damaging 1.00
R6323:Lrrc43 UTSW 5 123503886 missense probably damaging 1.00
R6869:Lrrc43 UTSW 5 123504276 critical splice donor site probably null
R6909:Lrrc43 UTSW 5 123500419 missense probably benign 0.14
R7023:Lrrc43 UTSW 5 123503763 missense probably damaging 1.00
X0024:Lrrc43 UTSW 5 123501318 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACTAGGCTGATAGCTCACC -3'
(R):5'- CGGAACTGGTGCTTCTCATTG -3'

Sequencing Primer
(F):5'- GCTCTGGGAGTCCATGAATAC -3'
(R):5'- CATTGGGAGACACGGTGATGTC -3'
Posted On2018-07-24