Incidental Mutation 'R6703:Ccser1'
ID528276
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Namecoiled-coil serine rich 1
Synonyms6230405M12Rik, C130092O11Rik, Fam190a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location61180324-62382865 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 61638511 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 94 (K94*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000067307] [ENSMUST00000126214]
Predicted Effect probably null
Transcript: ENSMUST00000045522
AA Change: K666*
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: K666*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067307
AA Change: K154*
SMART Domains Protein: ENSMUSP00000067639
Gene: ENSMUSG00000039578
AA Change: K154*

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
coiled coil region 162 191 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126214
AA Change: K666*
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: K666*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134710
AA Change: K94*
SMART Domains Protein: ENSMUSP00000122633
Gene: ENSMUSG00000039578
AA Change: K94*

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
coiled coil region 102 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145554
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTAACAGAGAAGGTAGCCATTC -3'
(R):5'- ACTGAAGGGGCTGAAATATTACC -3'

Sequencing Primer
(F):5'- CAGAGAAGGTAGCCATTCTATTTAAC -3'
(R):5'- GGGGCTGAAATATTACCTTTCTTC -3'
Posted On2018-07-24