Incidental Mutation 'R6703:Rab3a'
ID528288
Institutional Source Beutler Lab
Gene Symbol Rab3a
Ensembl Gene ENSMUSG00000031840
Gene NameRAB3A, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70754679-70758677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70756448 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000105720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034301] [ENSMUST00000038626] [ENSMUST00000110090] [ENSMUST00000110092] [ENSMUST00000110093] [ENSMUST00000143118]
Predicted Effect probably damaging
Transcript: ENSMUST00000034301
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034301
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038626
SMART Domains Protein: ENSMUSP00000037929
Gene: ENSMUSG00000035559

DomainStartEndE-ValueType
Pfam:Mpv17_PMP22 122 187 6.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110090
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105717
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110092
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105719
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110093
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105720
Gene: ENSMUSG00000031840
AA Change: D77G

DomainStartEndE-ValueType
RAB 23 186 1.27e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130468
Predicted Effect probably benign
Transcript: ENSMUST00000143118
SMART Domains Protein: ENSMUSP00000123384
Gene: ENSMUSG00000031840

DomainStartEndE-ValueType
Pfam:Miro 1 43 2.5e-6 PFAM
Pfam:Ras 1 62 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212385
Predicted Effect probably benign
Transcript: ENSMUST00000212617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213010
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Homozygous null mutants show impaired synaptic transmission, insulin secretion and glucose intolerance. This mutation and another chemically induced allele affect circadian period and sleep patterns. Heterozygotes show milder circadian rhythm anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Rab3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1070:Rab3a UTSW 8 70757194 missense probably damaging 1.00
R2196:Rab3a UTSW 8 70757226 missense probably benign 0.00
R5315:Rab3a UTSW 8 70755922 missense probably damaging 1.00
R6702:Rab3a UTSW 8 70756448 missense probably damaging 1.00
R7422:Rab3a UTSW 8 70756523 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCCAGTACATGTTTGTTGAGTGAC -3'
(R):5'- GAACCCAAGGCTTTGTCCTG -3'

Sequencing Primer
(F):5'- ACTAAGTGGCCTTGCAGTGAC -3'
(R):5'- TTTGTCCTGGCCAAGCAG -3'
Posted On2018-07-24