Mutagenetix > Incidental Mutation

Incidental Mutation 'R6703:Sorl1'

528290

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

Sorla, mSorLA, LR11, 2900010L19Rik

MMRRC Submission

044821-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.315) question?

Stock #

R6703 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41876016-42035593 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41982497 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 361 (V361E)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably damaging
Transcript: ENSMUST00000060989
AA Change: V361E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V361E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.0%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020N01Rik	T	A	10: 21,497,558 (GRCm39)	Y66*	probably null	Het
Akap13	T	C	7: 75,252,646 (GRCm39)	S259P	probably damaging	Het
Aoc1	A	C	6: 48,882,648 (GRCm39)	T197P	probably damaging	Het
Blnk	A	T	19: 40,950,950 (GRCm39)		probably null	Het
Ccser1	A	T	6: 61,615,495 (GRCm39)	K94*	probably null	Het
Cfap54	T	A	10: 92,704,596 (GRCm39)	D2828V	unknown	Het
Clec4n	A	G	6: 123,212,553 (GRCm39)	Q89R	probably null	Het
Col6a3	T	C	1: 90,707,161 (GRCm39)	D1984G	unknown	Het
Col6a3	C	T	1: 90,720,184 (GRCm39)	R1552Q	probably benign	Het
Csnk2a1	A	G	2: 152,100,608 (GRCm39)	T93A	probably benign	Het
Dna2	T	A	10: 62,809,073 (GRCm39)	I1055N	possibly damaging	Het
Dnm3	A	G	1: 162,146,256 (GRCm39)	F296L	probably benign	Het
Dock7	T	C	4: 98,834,909 (GRCm39)	E1822G	probably damaging	Het
Dpyd	A	T	3: 118,690,849 (GRCm39)		probably null	Het
Dyrk4	A	T	6: 126,867,045 (GRCm39)	I329N	probably damaging	Het
E4f1	C	A	17: 24,666,105 (GRCm39)	R231L	probably damaging	Het
Fat1	A	G	8: 45,406,083 (GRCm39)	T945A	probably benign	Het
Fkbp7	A	T	2: 76,502,106 (GRCm39)	M99K	probably damaging	Het
Flad1	T	C	3: 89,315,897 (GRCm39)	S222G	probably benign	Het
H1f7	C	A	15: 98,155,153 (GRCm39)		probably benign	Het
Ighg2b	T	C	12: 113,268,653 (GRCm39)		probably benign	Het
Iqub	T	A	6: 24,449,744 (GRCm39)	N707I	probably damaging	Het
Itln1	C	T	1: 171,358,151 (GRCm39)	C199Y	probably damaging	Het
Kctd3	G	A	1: 188,728,726 (GRCm39)	R137C	probably damaging	Het
Lamp5	C	G	2: 135,901,483 (GRCm39)	N102K	possibly damaging	Het
Larp7	C	T	3: 127,337,873 (GRCm39)	M395I	probably damaging	Het
Lpcat3	C	T	6: 124,640,185 (GRCm39)	A5V	probably benign	Het
Lrrc43	C	T	5: 123,637,532 (GRCm39)	T233M	possibly damaging	Het
Map4k1	T	G	7: 28,701,821 (GRCm39)	S803A	possibly damaging	Het
Mef2c	T	A	13: 83,773,525 (GRCm39)	C134S	possibly damaging	Het
Mgst2	T	C	3: 51,572,033 (GRCm39)		probably null	Het
Mug2	T	G	6: 122,055,653 (GRCm39)	I1112R	probably benign	Het
Myo15a	A	G	11: 60,383,818 (GRCm39)	I1622V	probably benign	Het
Ndor1	A	G	2: 25,139,902 (GRCm39)	F142S	possibly damaging	Het
Nectin3	A	G	16: 46,284,205 (GRCm39)	S160P	probably damaging	Het
Nudt16l2	T	C	9: 105,021,758 (GRCm39)	Y96C	possibly damaging	Het
Nynrin	A	G	14: 56,101,935 (GRCm39)	T535A	possibly damaging	Het
Or2m13	T	C	16: 19,226,122 (GRCm39)	I215V	probably benign	Het
Or4k15	A	G	14: 50,364,688 (GRCm39)	Y218C	probably damaging	Het
Or4k42	T	A	2: 111,320,454 (GRCm39)		probably null	Het
Or8b51	A	T	9: 38,569,073 (GRCm39)	I205N	possibly damaging	Het
Pcdh10	G	A	3: 45,335,734 (GRCm39)	V683M	possibly damaging	Het
Per2	C	T	1: 91,355,671 (GRCm39)	E696K	probably damaging	Het
Pif1	T	C	9: 65,500,545 (GRCm39)	V490A	probably damaging	Het
Plekhn1	A	T	4: 156,309,250 (GRCm39)	Y219N	probably benign	Het
Ppl	T	G	16: 4,907,328 (GRCm39)	E989A	probably damaging	Het
Prkdc	T	G	16: 15,488,392 (GRCm39)	S505A	probably benign	Het
Psg16	T	C	7: 16,824,321 (GRCm39)	L35P	probably damaging	Het
Ptges	A	G	2: 30,793,133 (GRCm39)	V33A	possibly damaging	Het
Qser1	G	A	2: 104,607,670 (GRCm39)	T1416I	possibly damaging	Het
Rab3a	A	G	8: 71,209,095 (GRCm39)	D77G	probably damaging	Het
Rtn3	A	T	19: 7,412,410 (GRCm39)	V788D	probably damaging	Het
Rtn4r	T	C	16: 17,969,055 (GRCm39)	L161P	probably damaging	Het
Rtn4rl1	G	A	11: 75,156,354 (GRCm39)	R262Q	probably benign	Het
S1pr3	A	T	13: 51,573,475 (GRCm39)	I219F	probably damaging	Het
Sec23b	A	T	2: 144,401,109 (GRCm39)		probably null	Het
Senp6	A	G	9: 80,029,203 (GRCm39)	E522G	probably damaging	Het
Slc27a6	A	G	18: 58,742,911 (GRCm39)	N533S	probably benign	Het
Slc39a5	T	A	10: 128,233,651 (GRCm39)	D282V	probably damaging	Het
Smc1b	C	T	15: 84,976,232 (GRCm39)	R825Q	probably benign	Het
Snx14	A	G	9: 88,304,967 (GRCm39)	I109T	probably damaging	Het
Sox5	G	T	6: 143,779,191 (GRCm39)	S648R	probably damaging	Het
Sptbn2	G	A	19: 4,799,842 (GRCm39)	S2161N	probably benign	Het
Sptbn2	C	A	19: 4,799,843 (GRCm39)	S2161R	probably benign	Het
St6galnac2	A	G	11: 116,575,213 (GRCm39)	S209P	probably benign	Het
Tmub1	T	C	5: 24,651,944 (GRCm39)	S7G	probably benign	Het
Trarg1	A	T	11: 76,584,988 (GRCm39)		probably null	Het
Trpm5	C	A	7: 142,623,055 (GRCm39)		probably benign	Het
Vmn2r106	C	T	17: 20,488,725 (GRCm39)	C558Y	probably damaging	Het
Zfp438	A	G	18: 5,214,044 (GRCm39)	S305P	probably benign	Het
Zfp780b	T	C	7: 27,671,066 (GRCm39)	T81A	possibly damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41,885,390 (GRCm39)	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	41,935,774 (GRCm39)	splice site	probably benign
IGL01545:Sorl1	APN	9	41,955,252 (GRCm39)	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	41,968,565 (GRCm39)	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	41,912,788 (GRCm39)	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41,892,007 (GRCm39)	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	41,915,330 (GRCm39)	missense	probably benign
IGL02215:Sorl1	APN	9	41,929,478 (GRCm39)	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	41,952,986 (GRCm39)	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	41,957,857 (GRCm39)	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	41,975,070 (GRCm39)	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	41,948,355 (GRCm39)	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	41,952,349 (GRCm39)	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	41,968,621 (GRCm39)	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41,902,722 (GRCm39)	missense	probably benign
IGL03288:Sorl1	APN	9	41,944,858 (GRCm39)	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	41,952,892 (GRCm39)	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41,879,918 (GRCm39)	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	41,944,873 (GRCm39)	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	41,993,250 (GRCm39)	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	41,943,205 (GRCm39)	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	41,915,384 (GRCm39)	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41,902,667 (GRCm39)	missense	probably null	0.00
R0512:Sorl1	UTSW	9	41,979,128 (GRCm39)	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41,895,802 (GRCm39)	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	41,955,196 (GRCm39)	splice site	probably benign
R0831:Sorl1	UTSW	9	41,982,365 (GRCm39)	splice site	probably benign
R0924:Sorl1	UTSW	9	41,919,470 (GRCm39)	splice site	probably benign
R1013:Sorl1	UTSW	9	41,913,855 (GRCm39)	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41,902,752 (GRCm39)	missense	probably benign
R1077:Sorl1	UTSW	9	41,925,786 (GRCm39)	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	41,943,092 (GRCm39)	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	41,911,708 (GRCm39)	splice site	probably null
R1498:Sorl1	UTSW	9	41,952,369 (GRCm39)	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41,885,296 (GRCm39)	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41,907,538 (GRCm39)	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42,001,261 (GRCm39)	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41,902,778 (GRCm39)	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41,881,021 (GRCm39)	nonsense	probably null
R1912:Sorl1	UTSW	9	41,993,246 (GRCm39)	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	41,957,920 (GRCm39)	missense	probably benign
R2071:Sorl1	UTSW	9	41,890,753 (GRCm39)	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41,895,788 (GRCm39)	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41,892,007 (GRCm39)	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	41,948,366 (GRCm39)	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41,881,077 (GRCm39)	missense	probably benign
R3815:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	41,915,401 (GRCm39)	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41,900,764 (GRCm39)	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	41,946,744 (GRCm39)	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	41,915,288 (GRCm39)	nonsense	probably null
R4610:Sorl1	UTSW	9	41,943,210 (GRCm39)	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	41,915,347 (GRCm39)	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	41,915,347 (GRCm39)	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41,895,804 (GRCm39)	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41,903,617 (GRCm39)	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	41,975,048 (GRCm39)	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	41,952,935 (GRCm39)	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	41,925,746 (GRCm39)	splice site	probably null
R4976:Sorl1	UTSW	9	41,894,299 (GRCm39)	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41,902,638 (GRCm39)	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41,907,590 (GRCm39)	missense	probably benign
R5070:Sorl1	UTSW	9	41,943,114 (GRCm39)	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41,887,673 (GRCm39)	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	41,944,879 (GRCm39)	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42,017,812 (GRCm39)	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	41,942,198 (GRCm39)	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41,890,686 (GRCm39)	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	41,968,580 (GRCm39)	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	41,968,580 (GRCm39)	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	41,913,932 (GRCm39)	nonsense	probably null
R5518:Sorl1	UTSW	9	41,948,508 (GRCm39)	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41,902,921 (GRCm39)	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42,003,669 (GRCm39)	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41,894,330 (GRCm39)	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41,881,038 (GRCm39)	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41,887,703 (GRCm39)	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	41,982,530 (GRCm39)	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	41,913,863 (GRCm39)	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	41,912,899 (GRCm39)	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41,891,941 (GRCm39)	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	41,913,863 (GRCm39)	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	41,982,497 (GRCm39)	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42,003,748 (GRCm39)	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42,010,559 (GRCm39)	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	41,935,694 (GRCm39)	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	41,933,688 (GRCm39)	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	41,944,922 (GRCm39)	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41,881,047 (GRCm39)	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	41,942,279 (GRCm39)	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	41,913,930 (GRCm39)	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42,035,375 (GRCm39)	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	41,948,499 (GRCm39)	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	41,975,006 (GRCm39)	splice site	probably null
R7537:Sorl1	UTSW	9	41,891,984 (GRCm39)	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41,888,878 (GRCm39)	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42,003,630 (GRCm39)	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41,895,822 (GRCm39)	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	41,955,205 (GRCm39)	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42,001,257 (GRCm39)	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41,900,655 (GRCm39)	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41,902,697 (GRCm39)	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41,888,857 (GRCm39)	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41,888,857 (GRCm39)	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	41,952,857 (GRCm39)	splice site	probably null
R8261:Sorl1	UTSW	9	41,925,777 (GRCm39)	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	41,942,294 (GRCm39)	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	41,929,456 (GRCm39)	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41,903,041 (GRCm39)	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41,903,041 (GRCm39)	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41,885,370 (GRCm39)	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	41,933,722 (GRCm39)	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	41,911,567 (GRCm39)	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	41,957,848 (GRCm39)	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	41,982,491 (GRCm39)	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	41,975,050 (GRCm39)	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41,885,420 (GRCm39)	nonsense	probably null
R9278:Sorl1	UTSW	9	41,957,857 (GRCm39)	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	41,952,927 (GRCm39)	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41,900,739 (GRCm39)	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	41,912,814 (GRCm39)	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42,035,384 (GRCm39)	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	41,933,631 (GRCm39)	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	41,993,105 (GRCm39)	nonsense	probably null
R9563:Sorl1	UTSW	9	41,957,893 (GRCm39)	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	41,957,893 (GRCm39)	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	41,993,105 (GRCm39)	nonsense	probably null
R9634:Sorl1	UTSW	9	41,907,590 (GRCm39)	missense	probably benign
R9671:Sorl1	UTSW	9	41,943,077 (GRCm39)	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42,003,766 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42,035,244 (GRCm39)	missense	probably benign	0.03
Z1176:Sorl1	UTSW	9	42,010,499 (GRCm39)	missense	possibly damaging	0.64
Z1177:Sorl1	UTSW	9	42,017,837 (GRCm39)	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	41,902,934 (GRCm39)	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42,035,208 (GRCm39)	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	41,952,892 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCCCATGGACAACTAATCTTG -3'
(R):5'- AGCTATGTCAGTTTGCAGGG -3'

Sequencing Primer
(F):5'- TAAGAAGAGTCTGGTGGCCTG -3'
(R):5'- CTATGTCAGTTTGCAGGGGGAGG -3'

Posted On

2018-07-24