Incidental Mutation 'R6703:Slc39a5'
ID528298
Institutional Source Beutler Lab
Gene Symbol Slc39a5
Ensembl Gene ENSMUSG00000039878
Gene Namesolute carrier family 39 (metal ion transporter), member 5
SynonymsZip5, 2010205A06Rik, 1810013D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128395931-128401229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128397782 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 282 (D282V)
Ref Sequence ENSEMBL: ENSMUSP00000131736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642] [ENSMUST00000026439] [ENSMUST00000042666] [ENSMUST00000164199] [ENSMUST00000164664] [ENSMUST00000166608] [ENSMUST00000167859] [ENSMUST00000172348] [ENSMUST00000218858] [ENSMUST00000219131]
Predicted Effect probably benign
Transcript: ENSMUST00000014642
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026439
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042666
AA Change: D282V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878
AA Change: D282V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164199
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164664
SMART Domains Protein: ENSMUSP00000127605
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 5.8e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166608
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167456
Predicted Effect probably damaging
Transcript: ENSMUST00000167859
AA Change: D282V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878
AA Change: D282V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172348
SMART Domains Protein: ENSMUSP00000127015
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 6.1e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179358
Predicted Effect probably benign
Transcript: ENSMUST00000218858
Predicted Effect probably benign
Transcript: ENSMUST00000219131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219222
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ZIP family of zinc transporters that transport zinc into cells from outside, and play a crucial role in controlling intracellular zinc levels. Zinc is an essential cofactor for many enzymes and proteins involved in gene transcription, growth, development and differentiation. Mutations in this gene have been associated with autosomal dominant high myopia (MYP24). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered zinc homeostasis and increased susceptibility to zinc-induced pancretitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Slc39a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Slc39a5 APN 10 128399330 missense probably benign 0.00
IGL02666:Slc39a5 APN 10 128398455 missense probably damaging 1.00
R0305:Slc39a5 UTSW 10 128398396 unclassified probably benign
R0350:Slc39a5 UTSW 10 128396750 critical splice donor site probably null
R0437:Slc39a5 UTSW 10 128399847 missense possibly damaging 0.94
R1401:Slc39a5 UTSW 10 128397741 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398410 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398411 missense probably damaging 1.00
R2286:Slc39a5 UTSW 10 128396060 missense probably benign 0.00
R4041:Slc39a5 UTSW 10 128396468 missense possibly damaging 0.95
R4649:Slc39a5 UTSW 10 128397267 missense probably benign 0.00
R4776:Slc39a5 UTSW 10 128397049 missense probably damaging 0.98
R4890:Slc39a5 UTSW 10 128398447 missense probably benign 0.13
R5911:Slc39a5 UTSW 10 128399943 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGTGATTGGCCAAGCGG -3'
(R):5'- TGTGTTTCTAGCCACAGCCC -3'

Sequencing Primer
(F):5'- CAAGCGGCCAAGGACCAG -3'
(R):5'- AGCCACAGCCCTTGTCC -3'
Posted On2018-07-24