Incidental Mutation 'R6703:Rtn4r'
ID528311
Institutional Source Beutler Lab
Gene Symbol Rtn4r
Ensembl Gene ENSMUSG00000043811
Gene Namereticulon 4 receptor
SynonymsNgR, Nogo-66 receptor, NgR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18127642-18152408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18151191 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 161 (L161P)
Ref Sequence ENSEMBL: ENSMUSP00000062924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059589]
Predicted Effect probably damaging
Transcript: ENSMUST00000059589
AA Change: L161P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062924
Gene: ENSMUSG00000043811
AA Change: L161P

DomainStartEndE-ValueType
LRRNT 26 61 2.32e0 SMART
LRR 60 79 8.49e1 SMART
LRR 80 103 8.01e0 SMART
LRR 104 128 1.22e1 SMART
LRR_TYP 129 152 4.11e-2 SMART
LRR_TYP 153 176 8.6e-5 SMART
LRR_TYP 177 200 5.67e-5 SMART
LRR 201 224 6.13e-1 SMART
LRR 225 248 6.4e0 SMART
LRRCT 260 310 1.65e-2 SMART
low complexity region 405 418 N/A INTRINSIC
low complexity region 446 464 N/A INTRINSIC
Meta Mutation Damage Score 0.67 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for reticulon 4, oligodendrocyte myelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased exploration in new environment, impaired coordination, and improved recovery and rubrospinal axon regeneration following spinal cord injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Rtn4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rtn4r APN 16 18151396 missense possibly damaging 0.68
IGL01647:Rtn4r APN 16 18151326 missense probably damaging 0.99
IGL01999:Rtn4r APN 16 18151457 missense possibly damaging 0.88
IGL02738:Rtn4r APN 16 18151188 missense probably damaging 1.00
R2064:Rtn4r UTSW 16 18151257 missense probably damaging 1.00
R4709:Rtn4r UTSW 16 18151182 missense probably damaging 1.00
R5465:Rtn4r UTSW 16 18151427 missense probably benign 0.00
R6155:Rtn4r UTSW 16 18151394 missense probably benign 0.02
R6267:Rtn4r UTSW 16 18151182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCTCACTATCCTGTGGCTGC -3'
(R):5'- ACACGAGCCACATGGTTCTG -3'

Sequencing Primer
(F):5'- TCTAATGCGCTGGCTCGGATC -3'
(R):5'- CCACATGGTTCTGGTGCAAGAG -3'
Posted On2018-07-24