Incidental Mutation 'R6736:Notch1'
ID528380
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6736 (G1)
Quality Score165.009
Status Not validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26460286 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2281 (T2281A)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288]
PDB Structure
The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028288
AA Change: T2281A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: T2281A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,992,268 I83T probably benign Het
Aadacl4 T G 4: 144,623,339 S389A possibly damaging Het
Abca13 A T 11: 9,465,058 S4042C probably damaging Het
Acaca G A 11: 84,238,838 V340I probably benign Het
Acox3 T A 5: 35,588,854 probably null Het
Acsl6 A C 11: 54,325,166 E124A probably damaging Het
Adamtsl1 T A 4: 86,342,247 H898Q probably damaging Het
Agl A G 3: 116,781,680 S603P probably damaging Het
Apobec1 A T 6: 122,581,675 M31K probably null Het
Armc4 C A 18: 7,223,586 V486F probably damaging Het
Astn1 T C 1: 158,511,148 probably null Het
Atp8a1 G T 5: 67,667,617 D790E probably damaging Het
Bahd1 T G 2: 118,915,975 M25R possibly damaging Het
BC034090 A T 1: 155,241,930 N147K possibly damaging Het
Bfsp2 G T 9: 103,480,204 A8E possibly damaging Het
Brwd1 A T 16: 96,068,572 I85N probably damaging Het
Ccdc24 T A 4: 117,870,535 N145I possibly damaging Het
Cdhr5 G T 7: 141,272,531 Q141K probably damaging Het
Cfap46 A G 7: 139,619,971 V1998A possibly damaging Het
Csmd1 T A 8: 16,002,626 Y2166F probably damaging Het
Cul4a T G 8: 13,136,219 S474A probably benign Het
Cutal A G 2: 34,888,137 T112A probably benign Het
Dcaf6 A C 1: 165,399,785 S258A possibly damaging Het
Dek C T 13: 47,099,390 V180M probably damaging Het
Dspp C A 5: 104,178,175 D801E unknown Het
Egflam T C 15: 7,219,725 T871A probably damaging Het
Erbin A T 13: 103,834,766 S781T possibly damaging Het
Erich6 A T 3: 58,625,054 H377Q probably damaging Het
Exo5 C A 4: 120,921,756 G304V probably damaging Het
Eya2 C A 2: 165,716,037 S184R possibly damaging Het
Fhod1 G A 8: 105,337,890 probably benign Het
G6pc3 A G 11: 102,193,670 Y302C possibly damaging Het
Gart T C 16: 91,636,107 D318G probably benign Het
Gm10300 T C 4: 132,074,935 probably benign Het
Gm11937 A G 11: 99,610,074 V39A probably damaging Het
Gm16432 T A 1: 178,017,712 Y99* probably null Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gnas T C 2: 174,334,251 M60T probably damaging Het
Grk5 G T 19: 60,890,626 R16L probably damaging Het
Hcn3 A G 3: 89,152,674 L221P probably damaging Het
Hddc3 G A 7: 80,343,196 R20Q possibly damaging Het
Hectd4 T C 5: 121,277,725 Y530H possibly damaging Het
Igf2bp1 A T 11: 95,973,122 H247Q probably benign Het
Igkv4-70 T A 6: 69,267,928 D103V probably damaging Het
Itpr2 T A 6: 146,325,170 M1359L probably damaging Het
Kalrn A G 16: 34,217,923 L1013S probably damaging Het
Kctd21 C T 7: 97,348,084 R255W probably damaging Het
Krt18 T A 15: 102,030,769 Y263N probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp1 G A 11: 58,042,647 probably null Het
Lmnb1 A G 18: 56,728,469 N144S probably damaging Het
Lrp2 T A 2: 69,448,211 T3933S probably benign Het
Lrrc34 T C 3: 30,624,859 N363S probably benign Het
Lrriq1 T C 10: 103,181,889 probably null Het
Mafa C A 15: 75,747,780 G48V unknown Het
Mboat4 T C 8: 34,124,521 S371P possibly damaging Het
Mei4 A T 9: 82,025,624 M237L probably benign Het
Mfsd2a T C 4: 122,951,261 D219G probably benign Het
Msl2 A G 9: 101,101,002 N192D probably damaging Het
Mycbp2 C A 14: 103,191,567 R2358M probably null Het
Myh10 A G 11: 68,745,339 T185A probably damaging Het
Nipsnap2 T C 5: 129,745,288 probably null Het
Olfr1165-ps C A 2: 88,101,603 C128F probably benign Het
Olfr1436 G A 19: 12,298,572 Q187* probably null Het
Olfr376 G T 11: 73,375,576 V276F probably benign Het
Olfr533 T C 7: 140,466,887 S229P probably damaging Het
Olfr533 G T 7: 140,466,921 C240F probably damaging Het
Olfr735 A T 14: 50,345,448 N300K probably damaging Het
Olfr895 T A 9: 38,268,570 I19N probably damaging Het
Olfr948 A G 9: 39,318,793 S274P probably damaging Het
Oxct1 T A 15: 4,092,417 S283T probably benign Het
Pcnx2 G T 8: 125,752,317 probably null Het
Piwil4 A G 9: 14,715,823 F424L probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn7 C T 1: 135,139,236 P277L probably benign Het
Rgs12 A G 5: 35,023,092 K27E probably damaging Het
Rp1l1 G T 14: 64,029,724 A920S possibly damaging Het
Rsbn1l A T 5: 20,908,224 H433Q probably benign Het
Safb C A 17: 56,606,023 P913Q possibly damaging Het
Sema7a G A 9: 57,960,571 V477M probably damaging Het
Serpina16 T A 12: 103,668,932 T408S possibly damaging Het
Six5 G A 7: 19,094,991 V119M possibly damaging Het
Slc6a16 C T 7: 45,259,028 P11S possibly damaging Het
Smg1 A G 7: 118,157,166 probably benign Het
Sntg1 T A 1: 8,445,050 I420F probably benign Het
Sptb T C 12: 76,613,180 D982G possibly damaging Het
Stag3 T A 5: 138,301,499 F891I probably damaging Het
Sugp1 A G 8: 70,059,303 E183G probably benign Het
Taf1d T C 9: 15,307,823 probably null Het
Tapbp T C 17: 33,919,957 S33P possibly damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubap2 CT CTTGCCCCGGT 4: 41,227,224 probably benign Het
Ubash3a A G 17: 31,231,415 T355A probably benign Het
Usp16 T G 16: 87,470,397 V225G probably damaging Het
Utrn A G 10: 12,621,303 V2454A probably benign Het
Vmn1r191 G T 13: 22,179,550 F11L probably benign Het
Vmn2r117 A T 17: 23,478,308 C137S probably damaging Het
Zfp143 T C 7: 110,091,814 M524T probably damaging Het
Zfp599 A G 9: 22,249,844 C342R probably damaging Het
Zfp777 T G 6: 48,024,856 K811Q probably damaging Het
Zfp870 T A 17: 32,883,596 H254L probably benign Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCATGCTATGCTGGAGGCC -3'
(R):5'- ACTTGTCAGATGTGGCCTC -3'

Sequencing Primer
(F):5'- CAGCTGCCTGTGTGCTCAG -3'
(R):5'- AGCAGTCTCCATCCATGCC -3'
Posted On2018-07-24