Incidental Mutation 'R6736:Acaca'
ID528446
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6736 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84238838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 340 (V340I)
Ref Sequence ENSEMBL: ENSMUSP00000099490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
Predicted Effect probably benign
Transcript: ENSMUST00000020843
AA Change: V340I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: V340I

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103201
AA Change: V340I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: V340I

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183548
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,992,268 I83T probably benign Het
Aadacl4 T G 4: 144,623,339 S389A possibly damaging Het
Abca13 A T 11: 9,465,058 S4042C probably damaging Het
Acox3 T A 5: 35,588,854 probably null Het
Acsl6 A C 11: 54,325,166 E124A probably damaging Het
Adamtsl1 T A 4: 86,342,247 H898Q probably damaging Het
Agl A G 3: 116,781,680 S603P probably damaging Het
Apobec1 A T 6: 122,581,675 M31K probably null Het
Armc4 C A 18: 7,223,586 V486F probably damaging Het
Astn1 T C 1: 158,511,148 probably null Het
Atp8a1 G T 5: 67,667,617 D790E probably damaging Het
Bahd1 T G 2: 118,915,975 M25R possibly damaging Het
BC034090 A T 1: 155,241,930 N147K possibly damaging Het
Bfsp2 G T 9: 103,480,204 A8E possibly damaging Het
Brwd1 A T 16: 96,068,572 I85N probably damaging Het
Ccdc24 T A 4: 117,870,535 N145I possibly damaging Het
Cdhr5 G T 7: 141,272,531 Q141K probably damaging Het
Cfap46 A G 7: 139,619,971 V1998A possibly damaging Het
Csmd1 T A 8: 16,002,626 Y2166F probably damaging Het
Cul4a T G 8: 13,136,219 S474A probably benign Het
Cutal A G 2: 34,888,137 T112A probably benign Het
Dcaf6 A C 1: 165,399,785 S258A possibly damaging Het
Dek C T 13: 47,099,390 V180M probably damaging Het
Dspp C A 5: 104,178,175 D801E unknown Het
Egflam T C 15: 7,219,725 T871A probably damaging Het
Erbin A T 13: 103,834,766 S781T possibly damaging Het
Erich6 A T 3: 58,625,054 H377Q probably damaging Het
Exo5 C A 4: 120,921,756 G304V probably damaging Het
Eya2 C A 2: 165,716,037 S184R possibly damaging Het
Fhod1 G A 8: 105,337,890 probably benign Het
G6pc3 A G 11: 102,193,670 Y302C possibly damaging Het
Gart T C 16: 91,636,107 D318G probably benign Het
Gm10300 T C 4: 132,074,935 probably benign Het
Gm11937 A G 11: 99,610,074 V39A probably damaging Het
Gm16432 T A 1: 178,017,712 Y99* probably null Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gnas T C 2: 174,334,251 M60T probably damaging Het
Grk5 G T 19: 60,890,626 R16L probably damaging Het
Hcn3 A G 3: 89,152,674 L221P probably damaging Het
Hddc3 G A 7: 80,343,196 R20Q possibly damaging Het
Hectd4 T C 5: 121,277,725 Y530H possibly damaging Het
Igf2bp1 A T 11: 95,973,122 H247Q probably benign Het
Igkv4-70 T A 6: 69,267,928 D103V probably damaging Het
Itpr2 T A 6: 146,325,170 M1359L probably damaging Het
Kalrn A G 16: 34,217,923 L1013S probably damaging Het
Kctd21 C T 7: 97,348,084 R255W probably damaging Het
Krt18 T A 15: 102,030,769 Y263N probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp1 G A 11: 58,042,647 probably null Het
Lmnb1 A G 18: 56,728,469 N144S probably damaging Het
Lrp2 T A 2: 69,448,211 T3933S probably benign Het
Lrrc34 T C 3: 30,624,859 N363S probably benign Het
Lrriq1 T C 10: 103,181,889 probably null Het
Mafa C A 15: 75,747,780 G48V unknown Het
Mboat4 T C 8: 34,124,521 S371P possibly damaging Het
Mei4 A T 9: 82,025,624 M237L probably benign Het
Mfsd2a T C 4: 122,951,261 D219G probably benign Het
Msl2 A G 9: 101,101,002 N192D probably damaging Het
Mycbp2 C A 14: 103,191,567 R2358M probably null Het
Myh10 A G 11: 68,745,339 T185A probably damaging Het
Nipsnap2 T C 5: 129,745,288 probably null Het
Notch1 T C 2: 26,460,286 T2281A probably benign Het
Olfr1165-ps C A 2: 88,101,603 C128F probably benign Het
Olfr1436 G A 19: 12,298,572 Q187* probably null Het
Olfr376 G T 11: 73,375,576 V276F probably benign Het
Olfr533 T C 7: 140,466,887 S229P probably damaging Het
Olfr533 G T 7: 140,466,921 C240F probably damaging Het
Olfr735 A T 14: 50,345,448 N300K probably damaging Het
Olfr895 T A 9: 38,268,570 I19N probably damaging Het
Olfr948 A G 9: 39,318,793 S274P probably damaging Het
Oxct1 T A 15: 4,092,417 S283T probably benign Het
Pcnx2 G T 8: 125,752,317 probably null Het
Piwil4 A G 9: 14,715,823 F424L probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn7 C T 1: 135,139,236 P277L probably benign Het
Rgs12 A G 5: 35,023,092 K27E probably damaging Het
Rp1l1 G T 14: 64,029,724 A920S possibly damaging Het
Rsbn1l A T 5: 20,908,224 H433Q probably benign Het
Safb C A 17: 56,606,023 P913Q possibly damaging Het
Sema7a G A 9: 57,960,571 V477M probably damaging Het
Serpina16 T A 12: 103,668,932 T408S possibly damaging Het
Six5 G A 7: 19,094,991 V119M possibly damaging Het
Slc6a16 C T 7: 45,259,028 P11S possibly damaging Het
Smg1 A G 7: 118,157,166 probably benign Het
Sntg1 T A 1: 8,445,050 I420F probably benign Het
Sptb T C 12: 76,613,180 D982G possibly damaging Het
Stag3 T A 5: 138,301,499 F891I probably damaging Het
Sugp1 A G 8: 70,059,303 E183G probably benign Het
Taf1d T C 9: 15,307,823 probably null Het
Tapbp T C 17: 33,919,957 S33P possibly damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubap2 CT CTTGCCCCGGT 4: 41,227,224 probably benign Het
Ubash3a A G 17: 31,231,415 T355A probably benign Het
Usp16 T G 16: 87,470,397 V225G probably damaging Het
Utrn A G 10: 12,621,303 V2454A probably benign Het
Vmn1r191 G T 13: 22,179,550 F11L probably benign Het
Vmn2r117 A T 17: 23,478,308 C137S probably damaging Het
Zfp143 T C 7: 110,091,814 M524T probably damaging Het
Zfp599 A G 9: 22,249,844 C342R probably damaging Het
Zfp777 T G 6: 48,024,856 K811Q probably damaging Het
Zfp870 T A 17: 32,883,596 H254L probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTGCTATAACTAAGAATGCAGCAC -3'
(R):5'- CACCTGTTCCATGTGTTCAAATAC -3'

Sequencing Primer
(F):5'- CAGCACATTAAAGATAGACAAAGGC -3'
(R):5'- CCATGTGTTCAAATACTGCTGG -3'
Posted On2018-07-24