Incidental Mutation 'R6694:Kit'
ID528487
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R6694 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75640757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 568 (V568A)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005815
AA Change: V572A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: V572A

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136002
Predicted Effect possibly damaging
Transcript: ENSMUST00000144270
AA Change: V568A

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: V568A

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151357
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATCATTGTGATGGTGCTCAC -3'
(R):5'- TGTGCAGTTTGACAGAAAGC -3'

Sequencing Primer
(F):5'- GTGCTCACCTACAAATATTTGCAG -3'
(R):5'- GCCTGTTTCTGGGAAACT -3'
Posted On2018-07-24