Incidental Mutation 'R6695:Olfr338'
ID528522
Institutional Source Beutler Lab
Gene Symbol Olfr338
Ensembl Gene ENSMUSG00000068950
Gene Nameolfactory receptor 338
SynonymsMOR136-5, GA_x6K02T2NLDC-33070879-33071799
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36373519-36382433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36377105 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 110 (S110C)
Ref Sequence ENSEMBL: ENSMUSP00000149146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072114] [ENSMUST00000091006] [ENSMUST00000217511]
Predicted Effect probably benign
Transcript: ENSMUST00000072114
AA Change: S110C

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071985
Gene: ENSMUSG00000068950
AA Change: S110C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-8 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091006
AA Change: S110C

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088528
Gene: ENSMUSG00000068950
AA Change: S110C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.9e-56 PFAM
Pfam:7tm_1 39 288 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217511
AA Change: S110C

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Olfr338
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr338 APN 2 36376916 missense probably damaging 0.99
IGL01089:Olfr338 APN 2 36377166 missense probably damaging 1.00
IGL01298:Olfr338 APN 2 36377448 missense probably benign 0.01
IGL01300:Olfr338 APN 2 36377042 missense probably benign 0.13
IGL01632:Olfr338 APN 2 36377564 missense probably benign 0.02
IGL02480:Olfr338 APN 2 36377492 missense probably damaging 0.98
IGL02519:Olfr338 APN 2 36377313 missense possibly damaging 0.84
IGL02658:Olfr338 APN 2 36377060 missense probably damaging 0.97
IGL02716:Olfr338 APN 2 36377343 missense possibly damaging 0.88
IGL02983:Olfr338 APN 2 36377637 missense probably damaging 1.00
IGL03334:Olfr338 APN 2 36377051 missense possibly damaging 0.66
IGL03054:Olfr338 UTSW 2 36376932 missense possibly damaging 0.65
R0469:Olfr338 UTSW 2 36377462 missense probably benign 0.02
R1263:Olfr338 UTSW 2 36376994 missense probably damaging 0.99
R1500:Olfr338 UTSW 2 36377621 missense probably benign 0.04
R2444:Olfr338 UTSW 2 36377613 missense possibly damaging 0.59
R5571:Olfr338 UTSW 2 36377117 missense probably benign 0.01
R5999:Olfr338 UTSW 2 36377310 missense probably damaging 1.00
R6030:Olfr338 UTSW 2 36377544 missense probably damaging 0.97
R6030:Olfr338 UTSW 2 36377544 missense probably damaging 0.97
R6351:Olfr338 UTSW 2 36377196 missense possibly damaging 0.78
R6785:Olfr338 UTSW 2 36376842 missense probably benign 0.12
R6785:Olfr338 UTSW 2 36376951 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACAACTGTGCTGGGGAAC -3'
(R):5'- TTTCTAAAGTGAGATAGGCAAGCC -3'

Sequencing Primer
(F):5'- TGCTCATCAGGCTGGACTC -3'
(R):5'- CCAAGAGAAGGGTGTGCAC -3'
Posted On2018-07-24