Incidental Mutation 'R6695:Knstrn'
ID528526
Institutional Source Beutler Lab
Gene Symbol Knstrn
Ensembl Gene ENSMUSG00000027331
Gene Namekinetochore-localized astrin/SPAG5 binding
Synonyms1700025D04Rik, D2Ertd750e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6695 (G1)
Quality Score217.009
Status Validated
Chromosome2
Chromosomal Location118814003-118853957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118814242 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 48 (A48T)
Ref Sequence ENSEMBL: ENSMUSP00000115860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028803] [ENSMUST00000063975] [ENSMUST00000110842] [ENSMUST00000110846] [ENSMUST00000123104] [ENSMUST00000134661]
Predicted Effect probably benign
Transcript: ENSMUST00000028803
SMART Domains Protein: ENSMUSP00000028803
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 118 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110842
SMART Domains Protein: ENSMUSP00000106466
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 91 132 N/A INTRINSIC
coiled coil region 168 210 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123104
SMART Domains Protein: ENSMUSP00000135422
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 104 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126045
SMART Domains Protein: ENSMUSP00000122844
Gene: ENSMUSG00000027331

DomainStartEndE-ValueType
coiled coil region 110 151 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134579
AA Change: A4T
Predicted Effect probably damaging
Transcript: ENSMUST00000134661
AA Change: A48T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115860
Gene: ENSMUSG00000027331
AA Change: A48T

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
coiled coil region 169 210 N/A INTRINSIC
coiled coil region 246 288 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177103
AA Change: A4T
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display reduced fertility, decreased testis size, oligozoospermia, and defects in early spermatogenesis associated with abnormal spermatogonia proliferation and increased testis apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Knstrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02370:Knstrn APN 2 118823788 critical splice donor site probably null
R0529:Knstrn UTSW 2 118830980 intron probably benign
R2202:Knstrn UTSW 2 118830975 unclassified probably null
R2203:Knstrn UTSW 2 118830975 unclassified probably null
R2204:Knstrn UTSW 2 118830975 unclassified probably null
R2430:Knstrn UTSW 2 118834103 utr 3 prime probably benign
R4672:Knstrn UTSW 2 118834031 missense probably damaging 0.98
R4672:Knstrn UTSW 2 118834032 missense possibly damaging 0.93
R5554:Knstrn UTSW 2 118833963 intron probably benign
R5954:Knstrn UTSW 2 118830955 intron probably benign
R6981:Knstrn UTSW 2 118834094 missense possibly damaging 0.80
R7269:Knstrn UTSW 2 118831388 intron probably null
Predicted Primers PCR Primer
(F):5'- TAGCTCCATTCAAGCCAGC -3'
(R):5'- CTTAGCACTGGCCATCGTAG -3'

Sequencing Primer
(F):5'- TTCAAGCCAGCCCAGTGAGTC -3'
(R):5'- GCCATCGTAGCCGGGTG -3'
Posted On2018-07-24