Incidental Mutation 'R6695:Zfp607b'
ID528535
Institutional Source Beutler Lab
Gene Symbol Zfp607b
Ensembl Gene ENSMUSG00000057093
Gene Namezinc finger protein 607B
SynonymsC030039L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27689340-27706484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27704039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 640 (V640A)
Ref Sequence ENSEMBL: ENSMUSP00000112494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076421] [ENSMUST00000120004]
Predicted Effect probably benign
Transcript: ENSMUST00000076421
AA Change: V640A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075755
Gene: ENSMUSG00000057093
AA Change: V640A

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120004
AA Change: V640A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112494
Gene: ENSMUSG00000057093
AA Change: V640A

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Other mutations in Zfp607b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Zfp607b APN 7 27698715 missense possibly damaging 0.75
IGL02114:Zfp607b APN 7 27703725 missense probably benign 0.19
IGL03171:Zfp607b APN 7 27693595 missense possibly damaging 0.70
IGL03329:Zfp607b APN 7 27703870 missense probably damaging 1.00
R0988:Zfp607b UTSW 7 27702976 missense probably benign 0.34
R1518:Zfp607b UTSW 7 27698662 missense possibly damaging 0.95
R1672:Zfp607b UTSW 7 27692523 missense possibly damaging 0.86
R1733:Zfp607b UTSW 7 27692524 missense possibly damaging 0.66
R1992:Zfp607b UTSW 7 27702524 missense possibly damaging 0.87
R2849:Zfp607b UTSW 7 27702394 missense probably benign 0.00
R3879:Zfp607b UTSW 7 27704051 missense possibly damaging 0.91
R4117:Zfp607b UTSW 7 27698682 missense probably damaging 0.97
R4439:Zfp607b UTSW 7 27702724 missense probably damaging 1.00
R4610:Zfp607b UTSW 7 27703695 missense probably damaging 1.00
R4755:Zfp607b UTSW 7 27703505 missense probably damaging 1.00
R4909:Zfp607b UTSW 7 27703796 missense probably benign
R5095:Zfp607b UTSW 7 27693636 intron probably benign
R5301:Zfp607b UTSW 7 27703747 missense probably benign
R5422:Zfp607b UTSW 7 27702388 missense probably benign 0.00
R5538:Zfp607b UTSW 7 27702869 missense probably damaging 1.00
R5546:Zfp607b UTSW 7 27702607 missense probably benign 0.19
R5644:Zfp607b UTSW 7 27703769 missense probably damaging 1.00
R5649:Zfp607b UTSW 7 27703981 missense probably damaging 1.00
R5692:Zfp607b UTSW 7 27703464 missense probably benign 0.17
R5945:Zfp607b UTSW 7 27702416 missense probably benign 0.06
R7402:Zfp607b UTSW 7 27693494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTGGCTCAGCTCACAC -3'
(R):5'- TTACTCCAGGACTTTCCAGGTGG -3'

Sequencing Primer
(F):5'- TGGCTCAGCTCACACGACAC -3'
(R):5'- AACACTGGTATGGTTTCCCAC -3'
Posted On2018-07-24