Incidental Mutation 'R6695:Galntl6'
ID528542
Institutional Source Beutler Lab
Gene Symbol Galntl6
Ensembl Gene ENSMUSG00000096914
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location57774052-58912640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58427770 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 116 (H116Q)
Ref Sequence ENSEMBL: ENSMUSP00000139677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146513] [ENSMUST00000188531] [ENSMUST00000204128]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077447
SMART Domains Protein: ENSMUSP00000076660
Gene: ENSMUSG00000061864

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glycos_transf_2 143 188 4.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146513
SMART Domains Protein: ENSMUSP00000118306
Gene: ENSMUSG00000096914

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188531
AA Change: H116Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139677
Gene: ENSMUSG00000096914
AA Change: H116Q

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 98 139 2.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204128
AA Change: H161Q

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145321
Gene: ENSMUSG00000096914
AA Change: H161Q

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 140 404 2.1e-9 PFAM
Pfam:Glycos_transf_2 143 328 7.3e-33 PFAM
Pfam:Glyco_tranf_2_2 143 356 1.2e-8 PFAM
Pfam:Glyco_transf_7C 297 371 6.2e-12 PFAM
RICIN 452 585 7.9e-21 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Galntl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Galntl6 APN 8 57857540 missense probably damaging 1.00
IGL00557:Galntl6 APN 8 58911417 missense possibly damaging 0.71
IGL01140:Galntl6 APN 8 57958322 missense probably damaging 1.00
IGL01412:Galntl6 APN 8 57777294 missense probably damaging 0.99
IGL01458:Galntl6 APN 8 58427709 missense probably damaging 1.00
IGL01575:Galntl6 APN 8 58427676 intron probably benign
IGL01700:Galntl6 APN 8 57958460 splice site probably benign
IGL01710:Galntl6 APN 8 58535968 missense probably damaging 0.97
IGL02611:Galntl6 APN 8 57958416 missense probably damaging 1.00
IGL02880:Galntl6 APN 8 57804272 missense probably benign 0.44
IGL03129:Galntl6 APN 8 58427716 missense probably damaging 1.00
IGL03215:Galntl6 APN 8 58911402 missense probably benign 0.00
IGL03249:Galntl6 APN 8 57777176 utr 3 prime probably benign
Indubitably UTSW 8 58427770 missense probably damaging 1.00
PIT4677001:Galntl6 UTSW 8 57857587 missense probably damaging 1.00
R0600:Galntl6 UTSW 8 57837183 splice site probably null
R0731:Galntl6 UTSW 8 58535984 missense probably benign
R0961:Galntl6 UTSW 8 58911340 missense probably benign
R1381:Galntl6 UTSW 8 58472955 missense probably damaging 0.99
R2137:Galntl6 UTSW 8 58535905 critical splice donor site probably null
R4632:Galntl6 UTSW 8 58427823 missense probably damaging 1.00
R4731:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4732:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4733:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4920:Galntl6 UTSW 8 58427773 missense probably damaging 0.97
R4964:Galntl6 UTSW 8 58699911 intron probably benign
R5357:Galntl6 UTSW 8 57884463 missense probably damaging 0.99
R5526:Galntl6 UTSW 8 58472970 missense probably benign
R5951:Galntl6 UTSW 8 57962402 missense probably benign 0.06
R5965:Galntl6 UTSW 8 57857531 missense probably benign 0.03
R6260:Galntl6 UTSW 8 57884481 missense probably damaging 1.00
R6368:Galntl6 UTSW 8 58911441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATCAAAGTTCCAATGGG -3'
(R):5'- GGGTTGGAAAATAGTACACAAATCC -3'

Sequencing Primer
(F):5'- CAATCAAAGTTCCAATGGGATGAAG -3'
(R):5'- GTACAGTGTGACCTGTGT -3'
Posted On2018-07-24