Incidental Mutation 'R6695:Mia2'
ID528549
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59172580 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 454 (H454R)
Ref Sequence ENSEMBL: ENSMUSP00000126538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
Predicted Effect probably damaging
Transcript: ENSMUST00000069430
AA Change: H476R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000
AA Change: H476R

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170992
AA Change: H454R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000
AA Change: H454R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175659
Predicted Effect unknown
Transcript: ENSMUST00000175837
AA Change: H128R
SMART Domains Protein: ENSMUSP00000134828
Gene: ENSMUSG00000021000
AA Change: H128R

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 90 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175877
AA Change: H426R

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000
AA Change: H426R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175912
AA Change: H467R

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000
AA Change: H467R

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176223
Predicted Effect possibly damaging
Transcript: ENSMUST00000176322
AA Change: H487R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000
AA Change: H487R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
AA Change: H443R

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000
AA Change: H443R

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176464
AA Change: H478R

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000
AA Change: H478R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176892
AA Change: H443R

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000
AA Change: H443R

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177162
AA Change: H478R

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000
AA Change: H478R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177222
Predicted Effect probably benign
Transcript: ENSMUST00000177225
AA Change: H450R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000
AA Change: H450R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219140
AA Change: H1079R

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTGGCATGAAACTCATTCC -3'
(R):5'- TAAAGTGCCACTGTAGTAGCC -3'

Sequencing Primer
(F):5'- GGCATGAAACTCATTCCTCTATTG -3'
(R):5'- AAGAGATTCTGTGGGAACTA -3'
Posted On2018-07-24