Incidental Mutation 'R6695:Sugct'
ID528550
Institutional Source Beutler Lab
Gene Symbol Sugct
Ensembl Gene ENSMUSG00000055137
Gene Namesuccinyl-CoA glutarate-CoA transferase
Synonyms5033411D12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location16857472-17695553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 17323230 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 286 (N286T)
Ref Sequence ENSEMBL: ENSMUSP00000070759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068545
AA Change: N286T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070759
Gene: ENSMUSG00000055137
AA Change: N286T

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
Pfam:CoA_transf_3 39 406 3.4e-127 PFAM
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to members of the CaiB/baiF CoA-transferase protein family. Mutations in this gene are associated with glutaric aciduria type III. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Cyp4f15 T A 17: 32,692,612 L156* probably null Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Sugct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Sugct APN 13 17662772 missense probably damaging 1.00
IGL00917:Sugct APN 13 16857918 nonsense probably null
IGL02118:Sugct APN 13 17452520 nonsense probably null
IGL02267:Sugct APN 13 17644865 missense possibly damaging 0.94
IGL02285:Sugct APN 13 17672596 missense possibly damaging 0.51
IGL02412:Sugct APN 13 17662801 missense probably damaging 1.00
IGL02420:Sugct APN 13 17452468 missense probably damaging 1.00
IGL02703:Sugct APN 13 17452540 missense possibly damaging 0.94
IGL03098:Sugct UTSW 13 17671736 missense probably damaging 1.00
R0024:Sugct UTSW 13 16857869 missense probably benign 0.01
R0024:Sugct UTSW 13 16857869 missense probably benign 0.01
R0058:Sugct UTSW 13 17672581 missense probably damaging 1.00
R1472:Sugct UTSW 13 17452546 missense probably benign 0.26
R1709:Sugct UTSW 13 17672566 missense probably damaging 0.99
R1780:Sugct UTSW 13 17452454 splice site probably null
R2189:Sugct UTSW 13 17662266 missense probably benign 0.09
R4420:Sugct UTSW 13 17452545 missense probably damaging 1.00
R4763:Sugct UTSW 13 17662787 missense probably damaging 1.00
R5197:Sugct UTSW 13 17323276 missense probably damaging 0.99
R5310:Sugct UTSW 13 17252560 nonsense probably null
R5401:Sugct UTSW 13 16857870 missense probably damaging 1.00
R6962:Sugct UTSW 13 16858021 splice site probably null
R6991:Sugct UTSW 13 17554380 missense probably benign 0.23
R7135:Sugct UTSW 13 17302009 missense probably benign 0.00
R7141:Sugct UTSW 13 17644787 missense possibly damaging 0.76
R7367:Sugct UTSW 13 17644814 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TACCAGCCCAGAAATGGTCC -3'
(R):5'- CCTGTCCAAAGTTCTACAGGG -3'

Sequencing Primer
(F):5'- TGGTCCCACCCACAAGG -3'
(R):5'- TGTGTTATGAAACATAAGCCTAGC -3'
Posted On2018-07-24