Incidental Mutation 'R6695:Cyp4f15'
ID528558
Institutional Source Beutler Lab
Gene Symbol Cyp4f15
Ensembl Gene ENSMUSG00000073424
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R6695 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32685627-32703352 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32692612 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 156 (L156*)
Ref Sequence ENSEMBL: ENSMUSP00000129264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008801] [ENSMUST00000168171]
Predicted Effect probably null
Transcript: ENSMUST00000008801
AA Change: L156*
SMART Domains Protein: ENSMUSP00000008801
Gene: ENSMUSG00000073424
AA Change: L156*

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:p450 57 520 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167789
Predicted Effect probably null
Transcript: ENSMUST00000168171
AA Change: L156*
SMART Domains Protein: ENSMUSP00000129264
Gene: ENSMUSG00000073424
AA Change: L156*

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:p450 57 527 3.2e-133 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F8, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and functions as a 19-hydroxylase of prostaglandins in seminal vesicles. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F3, is approximately 18 kb away. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd9 A T 12: 110,977,063 L179H probably benign Het
Cacna1h C A 17: 25,393,740 A370S probably damaging Het
Cc2d2a A T 5: 43,718,677 I1053F probably damaging Het
Csmd3 A G 15: 47,857,834 V1467A probably damaging Het
Dmwd T A 7: 19,080,727 L434Q probably damaging Het
Dtx4 T A 19: 12,473,235 R538* probably null Het
Fcgbp T A 7: 28,086,270 C377* probably null Het
Galntl6 G T 8: 58,427,770 H116Q probably damaging Het
Herc1 T A 9: 66,483,866 probably null Het
Hydin T G 8: 110,326,460 S255A probably benign Het
Knstrn G A 2: 118,814,242 A48T probably damaging Het
Lonrf2 T C 1: 38,813,389 D127G probably benign Het
Luzp1 T C 4: 136,545,298 S12P possibly damaging Het
Man2c1 A T 9: 57,141,591 H822L probably benign Het
Map3k13 G T 16: 21,922,278 G785V probably benign Het
Mia2 A G 12: 59,172,580 H454R probably damaging Het
Mib2 G A 4: 155,661,172 R61C probably damaging Het
Muc15 A T 2: 110,731,271 L17F probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nav2 A G 7: 49,464,904 I879V probably benign Het
Nomo1 T A 7: 46,066,461 S751T probably benign Het
Olfr1449 A T 19: 12,935,400 I221L possibly damaging Het
Olfr338 A T 2: 36,377,105 S110C probably benign Het
Olfr996 A G 2: 85,579,449 D70G probably damaging Het
Pcdhac2 A G 18: 37,145,203 N412S probably benign Het
Plk5 T C 10: 80,360,201 S235P probably benign Het
Ppm1j A G 3: 104,785,486 D437G probably damaging Het
Rab11fip1 T C 8: 27,143,234 E1148G probably damaging Het
Rad9b T C 5: 122,351,691 N43S probably damaging Het
Rc3h2 A C 2: 37,414,661 I29S possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Spdl1 T A 11: 34,823,003 probably null Het
Spta1 A T 1: 174,244,042 probably null Het
Stk32c A T 7: 139,122,964 V53E probably damaging Het
Strc A T 2: 121,377,224 F555L probably benign Het
Sugct T G 13: 17,323,230 N286T possibly damaging Het
Swsap1 A T 9: 21,956,675 probably null Het
Thbs2 T A 17: 14,674,164 D807V possibly damaging Het
Tnrc6b A G 15: 80,879,773 D492G probably damaging Het
Tonsl A T 15: 76,629,818 S1184T possibly damaging Het
Tpp2 T A 1: 43,983,276 Y945N probably benign Het
Usp54 G T 14: 20,560,869 A1293D possibly damaging Het
Vps52 A T 17: 33,963,199 K516* probably null Het
Zbtb17 T A 4: 141,461,799 V10D probably damaging Het
Zfp607b T C 7: 27,704,039 V640A probably benign Het
Other mutations in Cyp4f15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Cyp4f15 APN 17 32686157 missense probably benign 0.01
IGL01813:Cyp4f15 APN 17 32686157 missense probably benign 0.01
IGL02394:Cyp4f15 APN 17 32692635 missense possibly damaging 0.76
IGL02547:Cyp4f15 APN 17 32700255 missense probably benign 0.03
IGL02743:Cyp4f15 APN 17 32699952 missense possibly damaging 0.56
IGL03120:Cyp4f15 APN 17 32690764 missense probably damaging 0.97
IGL03124:Cyp4f15 APN 17 32685812 critical splice donor site probably null
IGL03342:Cyp4f15 APN 17 32697936 missense probably damaging 1.00
PIT4472001:Cyp4f15 UTSW 17 32702824 missense probably damaging 0.99
R2016:Cyp4f15 UTSW 17 32702159 missense probably damaging 1.00
R2892:Cyp4f15 UTSW 17 32686208 missense probably benign
R3812:Cyp4f15 UTSW 17 32686177 missense probably benign
R4803:Cyp4f15 UTSW 17 32692580 missense probably benign 0.00
R5180:Cyp4f15 UTSW 17 32690740 missense probably benign 0.21
R5199:Cyp4f15 UTSW 17 32702372 missense probably benign
R5787:Cyp4f15 UTSW 17 32702808 missense probably damaging 1.00
Z1088:Cyp4f15 UTSW 17 32692690 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTAGTCTTCTACAGTTTCCTGAAAC -3'
(R):5'- TGAGCACTCAATGGCTCTTTG -3'

Sequencing Primer
(F):5'- AAACCTTGGCTGGGTGAGTACTAC -3'
(R):5'- CTGCAGTCGGATCACAATGCATG -3'
Posted On2018-07-24