Incidental Mutation 'R6697:C2cd6'
List |< first << previous [record 64 of 585] next >> last >|
ID528611
Institutional Source Beutler Lab
Gene Symbol C2cd6
Ensembl Gene ENSMUSG00000072295
Gene NameC2 calcium dependent domain containing 6
Synonyms4930408G06Rik, Als2cr11, 1700052H20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R6697 (G1)
Quality Score217.468
Status Not validated
Chromosome1
Chromosomal Location59050506-59094900 bp(-) (GRCm38)
Type of Mutationsmall deletion (5 aa in frame mutation)
DNA Base Change (assembly) ATGTGGCCTGTCTTCT to A at 59051088 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097080]
Predicted Effect probably benign
Transcript: ENSMUST00000097080
SMART Domains Protein: ENSMUSP00000094845
Gene: ENSMUSG00000072295

DomainStartEndE-ValueType
low complexity region 99 126 N/A INTRINSIC
Pfam:ALS2CR11 128 533 1.2e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188707
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,406,126 S562* probably null Het
Arhgap9 T C 10: 127,322,120 F2S probably benign Het
Clk1 A G 1: 58,414,622 S298P probably benign Het
Col7a1 T A 9: 108,970,533 L1834Q probably damaging Het
Dip2c T C 13: 9,621,913 L1007P probably damaging Het
Erich3 G T 3: 154,764,270 probably benign Het
Fam209 A G 2: 172,474,203 E166G probably damaging Het
Fbxl4 A G 4: 22,376,599 T12A probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Grin2a T C 16: 9,669,840 D398G possibly damaging Het
Hmx2 T C 7: 131,555,934 L259P probably damaging Het
Macc1 A T 12: 119,447,256 R586S possibly damaging Het
Map3k14 T C 11: 103,227,064 E634G probably benign Het
Mettl21e G T 1: 44,210,167 L110I probably damaging Het
Mgst1 A G 6: 138,147,753 I22V probably damaging Het
Muc16 T C 9: 18,641,291 T4569A probably benign Het
Neu4 A G 1: 94,025,030 K374E probably benign Het
Nufip1 A G 14: 76,133,073 T405A probably benign Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Sssca1 A G 19: 5,730,430 L180P probably damaging Het
Tial1 G T 7: 128,444,869 Q68K possibly damaging Het
Zp1 T A 19: 10,914,835 I62L probably benign Het
Other mutations in C2cd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:C2cd6 APN 1 59077945 missense probably damaging 0.97
IGL01012:C2cd6 APN 1 58997348 unclassified probably benign
IGL01682:C2cd6 APN 1 59062501 missense probably damaging 1.00
IGL01834:C2cd6 APN 1 58997445 unclassified probably benign
IGL01982:C2cd6 APN 1 59067773 splice site probably benign
IGL02027:C2cd6 APN 1 59060604 missense probably benign 0.12
IGL02069:C2cd6 APN 1 59052541 splice site probably benign
IGL02232:C2cd6 APN 1 59062492 missense probably damaging 0.99
IGL02280:C2cd6 APN 1 59077881 critical splice donor site probably null
IGL02392:C2cd6 APN 1 59094838 missense probably benign 0.00
IGL02440:C2cd6 APN 1 59075100 missense probably benign 0.14
IGL02469:C2cd6 APN 1 58997481 unclassified probably benign
IGL02660:C2cd6 APN 1 59051230 missense probably damaging 1.00
IGL02720:C2cd6 APN 1 59051148 missense probably damaging 0.98
IGL03340:C2cd6 APN 1 59076671 missense probably benign 0.07
R1472:C2cd6 UTSW 1 59067785 missense possibly damaging 0.92
R1476:C2cd6 UTSW 1 59076728 splice site probably benign
R1753:C2cd6 UTSW 1 59094833 missense possibly damaging 0.53
R3724:C2cd6 UTSW 1 59066235 splice site probably benign
R4887:C2cd6 UTSW 1 59094734 missense probably benign 0.00
R5115:C2cd6 UTSW 1 59051261 missense probably benign 0.12
R6406:C2cd6 UTSW 1 59058676 missense possibly damaging 0.60
R6467:C2cd6 UTSW 1 59077934 missense probably benign 0.01
R6801:C2cd6 UTSW 1 59094583 frame shift probably null
R6882:C2cd6 UTSW 1 59066159 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCATTTCAACTCTCAGGAGCC -3'
(R):5'- TAAGGAAGGCCGGGTCATAC -3'

Sequencing Primer
(F):5'- TTTCAACTCTCAGGAGCCCAAACTAG -3'
(R):5'- GCCGGGTCATACCAGTTTTAAAG -3'
Posted On2018-07-24