Incidental Mutation 'R6697:Grin2a'
ID 528630
Institutional Source Beutler Lab
Gene Symbol Grin2a
Ensembl Gene ENSMUSG00000059003
Gene Name glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms GluN2A, GluRepsilon1, NR2A, NMDAR2A
MMRRC Submission 044815-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.463) question?
Stock # R6697 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 9385762-9813424 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9487704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 398 (D398G)
Ref Sequence ENSEMBL: ENSMUSP00000142900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]
AlphaFold P35436
Predicted Effect possibly damaging
Transcript: ENSMUST00000032331
AA Change: D398G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: D398G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115835
AA Change: D398G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: D398G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 99 300 9.2e-11 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 1.2e-266 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199708
AA Change: D398G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: D398G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb G T 10: 10,281,870 (GRCm39) S562* probably null Het
Arhgap9 T C 10: 127,157,989 (GRCm39) F2S probably benign Het
C2cd6 ATGTGGCCTGTCTTCT A 1: 59,090,247 (GRCm39) probably benign Het
Clk1 A G 1: 58,453,781 (GRCm39) S298P probably benign Het
Col7a1 T A 9: 108,799,601 (GRCm39) L1834Q probably damaging Het
Dip2c T C 13: 9,671,949 (GRCm39) L1007P probably damaging Het
Erich3 G T 3: 154,469,907 (GRCm39) probably benign Het
Fam209 A G 2: 172,316,123 (GRCm39) E166G probably damaging Het
Fbxl4 A G 4: 22,376,599 (GRCm39) T12A probably benign Het
Grid2 C G 6: 63,908,031 (GRCm39) R224G possibly damaging Het
Hmx2 T C 7: 131,157,663 (GRCm39) L259P probably damaging Het
Macc1 A T 12: 119,410,991 (GRCm39) R586S possibly damaging Het
Map3k14 T C 11: 103,117,890 (GRCm39) E634G probably benign Het
Mettl21e G T 1: 44,249,327 (GRCm39) L110I probably damaging Het
Mgst1 A G 6: 138,124,751 (GRCm39) I22V probably damaging Het
Muc16 T C 9: 18,552,587 (GRCm39) T4569A probably benign Het
Neu4 A G 1: 93,952,752 (GRCm39) K374E probably benign Het
Nufip1 A G 14: 76,370,513 (GRCm39) T405A probably benign Het
Rilpl2 C T 5: 124,607,843 (GRCm39) E126K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Tial1 G T 7: 128,046,593 (GRCm39) Q68K possibly damaging Het
Znrd2 A G 19: 5,780,458 (GRCm39) L180P probably damaging Het
Zp1 T A 19: 10,892,199 (GRCm39) I62L probably benign Het
Other mutations in Grin2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Grin2a APN 16 9,461,994 (GRCm39) missense probably benign 0.29
IGL03288:Grin2a APN 16 9,487,704 (GRCm39) missense possibly damaging 0.85
IGL02796:Grin2a UTSW 16 9,402,972 (GRCm39) missense possibly damaging 0.72
PIT4402001:Grin2a UTSW 16 9,462,063 (GRCm39) missense possibly damaging 0.77
PIT4494001:Grin2a UTSW 16 9,402,960 (GRCm39) missense probably damaging 0.98
R0055:Grin2a UTSW 16 9,487,671 (GRCm39) missense probably damaging 0.99
R0055:Grin2a UTSW 16 9,487,671 (GRCm39) missense probably damaging 0.99
R0164:Grin2a UTSW 16 9,812,685 (GRCm39) critical splice donor site probably null
R0164:Grin2a UTSW 16 9,812,685 (GRCm39) critical splice donor site probably null
R0211:Grin2a UTSW 16 9,397,037 (GRCm39) missense possibly damaging 0.86
R0390:Grin2a UTSW 16 9,397,449 (GRCm39) missense possibly damaging 0.85
R0659:Grin2a UTSW 16 9,810,336 (GRCm39) missense probably damaging 0.98
R0661:Grin2a UTSW 16 9,810,336 (GRCm39) missense probably damaging 0.98
R0734:Grin2a UTSW 16 9,397,475 (GRCm39) missense possibly damaging 0.71
R1524:Grin2a UTSW 16 9,481,467 (GRCm39) missense possibly damaging 0.55
R1542:Grin2a UTSW 16 9,397,067 (GRCm39) missense probably damaging 0.98
R1556:Grin2a UTSW 16 9,525,579 (GRCm39) missense probably benign 0.18
R1605:Grin2a UTSW 16 9,481,194 (GRCm39) missense possibly damaging 0.46
R1792:Grin2a UTSW 16 9,810,259 (GRCm39) missense possibly damaging 0.53
R2024:Grin2a UTSW 16 9,462,107 (GRCm39) missense possibly damaging 0.76
R2057:Grin2a UTSW 16 9,487,608 (GRCm39) missense probably benign 0.14
R2344:Grin2a UTSW 16 9,481,099 (GRCm39) missense probably benign 0.03
R2847:Grin2a UTSW 16 9,579,829 (GRCm39) missense possibly damaging 0.73
R2848:Grin2a UTSW 16 9,579,829 (GRCm39) missense possibly damaging 0.73
R2981:Grin2a UTSW 16 9,462,087 (GRCm39) missense possibly damaging 0.89
R4197:Grin2a UTSW 16 9,579,831 (GRCm39) missense probably damaging 1.00
R4342:Grin2a UTSW 16 9,471,453 (GRCm39) missense possibly damaging 0.52
R4741:Grin2a UTSW 16 9,481,376 (GRCm39) missense probably damaging 1.00
R4891:Grin2a UTSW 16 9,475,570 (GRCm39) missense possibly damaging 0.51
R4925:Grin2a UTSW 16 9,487,687 (GRCm39) missense probably damaging 0.98
R5563:Grin2a UTSW 16 9,525,581 (GRCm39) missense probably benign 0.18
R5645:Grin2a UTSW 16 9,810,090 (GRCm39) missense probably damaging 0.98
R5769:Grin2a UTSW 16 9,579,390 (GRCm39) missense possibly damaging 0.89
R5885:Grin2a UTSW 16 9,579,769 (GRCm39) missense possibly damaging 0.95
R6065:Grin2a UTSW 16 9,579,771 (GRCm39) missense possibly damaging 0.92
R6083:Grin2a UTSW 16 9,397,404 (GRCm39) missense probably benign 0.02
R6137:Grin2a UTSW 16 9,471,313 (GRCm39) missense probably benign 0.32
R6286:Grin2a UTSW 16 9,579,639 (GRCm39) missense possibly damaging 0.93
R6342:Grin2a UTSW 16 9,397,198 (GRCm39) missense probably damaging 0.98
R6924:Grin2a UTSW 16 9,481,092 (GRCm39) missense possibly damaging 0.71
R7070:Grin2a UTSW 16 9,397,288 (GRCm39) missense possibly damaging 0.92
R7235:Grin2a UTSW 16 9,397,129 (GRCm39) missense probably damaging 0.98
R7274:Grin2a UTSW 16 9,396,986 (GRCm39) missense possibly damaging 0.71
R7669:Grin2a UTSW 16 9,810,327 (GRCm39) missense probably benign
R7990:Grin2a UTSW 16 9,397,040 (GRCm39) missense possibly damaging 0.71
R8261:Grin2a UTSW 16 9,481,382 (GRCm39) missense probably damaging 0.97
R8503:Grin2a UTSW 16 9,481,413 (GRCm39) missense probably damaging 0.97
R8679:Grin2a UTSW 16 9,403,089 (GRCm39) missense possibly damaging 0.90
R8700:Grin2a UTSW 16 9,397,412 (GRCm39) missense probably benign 0.32
R8823:Grin2a UTSW 16 9,487,758 (GRCm39) missense possibly damaging 0.96
R9122:Grin2a UTSW 16 9,397,186 (GRCm39) missense possibly damaging 0.93
R9656:Grin2a UTSW 16 9,397,471 (GRCm39) missense possibly damaging 0.71
R9674:Grin2a UTSW 16 9,471,265 (GRCm39) nonsense probably null
R9786:Grin2a UTSW 16 9,471,466 (GRCm39) missense possibly damaging 0.71
X0024:Grin2a UTSW 16 9,481,063 (GRCm39) missense probably benign 0.36
Z1177:Grin2a UTSW 16 9,481,441 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGACTGGATTATAGACACTGTTGC -3'
(R):5'- ACATCCAGGTCCTCACCATTTG -3'

Sequencing Primer
(F):5'- GGATTATAGACACTGTTGCATGAGC -3'
(R):5'- AGGTCCTCACCATTTGTTACC -3'
Posted On 2018-07-24