Incidental Mutation 'R6698:Gsdmc3'
ID528663
Institutional Source Beutler Lab
Gene Symbol Gsdmc3
Ensembl Gene ENSMUSG00000055827
Gene Namegasdermin C3
Synonyms9930109F21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6698 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location63857724-63878558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63860271 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 302 (F302S)
Ref Sequence ENSEMBL: ENSMUSP00000139472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089894] [ENSMUST00000185526] [ENSMUST00000190682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089894
AA Change: F302S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087339
Gene: ENSMUSG00000055827
AA Change: F302S

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 2.1e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185526
AA Change: F302S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140272
Gene: ENSMUSG00000055827
AA Change: F302S

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190682
AA Change: F302S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139472
Gene: ENSMUSG00000055827
AA Change: F302S

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 T C 5: 150,532,394 V200A probably damaging Het
Camk2g T A 14: 20,742,708 K393* probably null Het
Catsperb T A 12: 101,509,207 F337I probably damaging Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Col6a5 T A 9: 105,934,175 N715I unknown Het
Fam198b A G 3: 79,936,595 I10V probably damaging Het
Fancg A G 4: 43,007,034 S248P probably benign Het
Flvcr1 T C 1: 191,025,732 Y79C probably damaging Het
Gabrp A G 11: 33,557,017 S198P probably damaging Het
Glp1r A G 17: 30,936,401 Y454C probably damaging Het
Gpr158 A C 2: 21,827,110 D1007A probably damaging Het
Gsdmc4 T A 15: 63,893,764 D312V probably benign Het
Itga5 T C 15: 103,351,381 Y663C probably benign Het
Kif1b A T 4: 149,274,956 M108K probably damaging Het
Klf11 T G 12: 24,653,619 S18A probably damaging Het
Lmtk2 T C 5: 144,174,919 V819A probably benign Het
Lrba A G 3: 86,304,425 M451V probably damaging Het
Lrp1b T C 2: 41,302,946 D488G probably damaging Het
Mark4 T C 7: 19,429,437 N589S probably benign Het
Mis12 T C 11: 71,025,186 F15S probably damaging Het
Nif3l1 A G 1: 58,450,489 D179G probably benign Het
Nlrx1 A G 9: 44,265,807 W3R probably damaging Het
Nup210l G A 3: 90,182,508 S1194N possibly damaging Het
Olfr1165-ps A G 2: 88,101,217 F257L unknown Het
Olfr451-ps1 A T 6: 42,801,202 T154S probably benign Het
Park2 A G 17: 11,067,296 probably null Het
Pnkd T A 1: 74,350,677 L320Q probably damaging Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Homo
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rpn2 T C 2: 157,297,410 I208T possibly damaging Het
Skint4 G T 4: 112,119,899 C170F probably damaging Het
Synj1 C G 16: 90,960,452 V877L probably damaging Het
Tcp11 A T 17: 28,071,830 I106N possibly damaging Het
Tg A G 15: 66,839,362 Y991C probably damaging Het
Trib3 A G 2: 152,338,419 S285P probably damaging Het
Wdr49 A T 3: 75,429,366 W345R probably benign Het
Wnt5a A G 14: 28,518,463 Y190C possibly damaging Het
Xpo1 A G 11: 23,294,040 E955G probably benign Het
Other mutations in Gsdmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gsdmc3 APN 15 63859677 missense probably benign 0.05
IGL01125:Gsdmc3 APN 15 63861457 missense probably benign 0.09
R0490:Gsdmc3 UTSW 15 63860250 missense possibly damaging 0.88
R0620:Gsdmc3 UTSW 15 63859693 missense probably damaging 1.00
R0932:Gsdmc3 UTSW 15 63858551 critical splice acceptor site probably null
R1298:Gsdmc3 UTSW 15 63860281 missense probably damaging 0.99
R1378:Gsdmc3 UTSW 15 63859586 splice site probably benign
R1815:Gsdmc3 UTSW 15 63869116 missense probably damaging 1.00
R1962:Gsdmc3 UTSW 15 63858466 missense probably damaging 1.00
R1965:Gsdmc3 UTSW 15 63858447 missense probably damaging 1.00
R2088:Gsdmc3 UTSW 15 63860214 critical splice donor site probably null
R2090:Gsdmc3 UTSW 15 63866782 missense probably benign 0.07
R2126:Gsdmc3 UTSW 15 63858534 nonsense probably null
R2276:Gsdmc3 UTSW 15 63860256 missense probably benign 0.09
R4412:Gsdmc3 UTSW 15 63866796 missense probably benign 0.18
R4913:Gsdmc3 UTSW 15 63858273 makesense probably null
R5241:Gsdmc3 UTSW 15 63864146 missense possibly damaging 0.96
R6016:Gsdmc3 UTSW 15 63868412 missense probably benign 0.07
R6026:Gsdmc3 UTSW 15 63866751 missense probably damaging 1.00
R6291:Gsdmc3 UTSW 15 63860241 missense probably benign 0.00
R7316:Gsdmc3 UTSW 15 63858402 missense possibly damaging 0.81
R7566:Gsdmc3 UTSW 15 63861661 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCTGAAATCCCCACCTTTGAC -3'
(R):5'- TCAAGCAGGCTGTCAATTGAG -3'

Sequencing Primer
(F):5'- GACATCTTTCTCAGTGTCGTCAG -3'
(R):5'- GGCTGTCAATTGAGACATTTTTAGC -3'
Posted On2018-07-24