Incidental Mutation 'R6701:Eml6'
ID528759
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29785748 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1139 (L1139F)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably damaging
Transcript: ENSMUST00000058902
AA Change: L1139F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: L1139F

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Hsd17b1 C A 11: 101,080,155 C312* probably null Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCTGCGTTCATAAGTTG -3'
(R):5'- CTCAAGGTCAAATTTTATGAGGTCC -3'

Sequencing Primer
(F):5'- CAGAAGCCCTGTTACTGGAGTTAC -3'
(R):5'- AAGAGTTTTGGGGATTATTCCATG -3'
Posted On2018-07-24