Incidental Mutation 'R6701:Hsd17b1'
ID528765
Institutional Source Beutler Lab
Gene Symbol Hsd17b1
Ensembl Gene ENSMUSG00000019301
Gene Namehydroxysteroid (17-beta) dehydrogenase 1
SynonymsHsd17ba, 17beta-HSD
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6701 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101078411-101080527 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 101080155 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 312 (C312*)
Ref Sequence ENSEMBL: ENSMUSP00000019445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001802] [ENSMUST00000001806] [ENSMUST00000019445] [ENSMUST00000107308]
Predicted Effect probably benign
Transcript: ENSMUST00000001802
SMART Domains Protein: ENSMUSP00000001802
Gene: ENSMUSG00000001751

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NAGLU_N 28 114 4.8e-24 PFAM
Pfam:NAGLU 128 463 8.2e-150 PFAM
Pfam:NAGLU_C 471 731 4.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001806
SMART Domains Protein: ENSMUSP00000001806
Gene: ENSMUSG00000001755

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_2 194 338 1.4e-11 PFAM
Pfam:CoaE 358 536 5.6e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019445
AA Change: C312*
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301
AA Change: C312*

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107308
SMART Domains Protein: ENSMUSP00000102929
Gene: ENSMUSG00000001755

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Pfam:CTP_transf_like 194 338 5.3e-11 PFAM
Pfam:CoaE 358 536 1.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151686
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 17beta-hydroxysteroid dehydrogenase family of short-chain dehydrogenases/reductases. It has a dual function in estrogen activation and androgen inactivation and plays a major role in establishing the estrogen E2 concentration gradient between serum and peripheral tissues. The encoded protein catalyzes the last step in estrogen activation, using NADPH to convert estrogens E1 and E2 and androgens like 4-androstenedione, to testosterone. It has an N-terminal short-chain dehydrogenase domain with a cofactor binding site, and a narrow, hydrophobic C-terminal domain with a steroid substrate binding site. This gene is expressed primarily in the placenta and ovarian granulosa cells, and to a lesser extent, in the endometrium, adipose tissue, and prostate. Polymorphisms in this gene have been linked to breast and prostate cancer. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe female subfertility with defects in leteunization and progesterone production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A T 10: 4,355,243 K684N probably damaging Het
Akna C T 4: 63,395,280 G202D probably benign Het
Alpk1 T A 3: 127,729,336 D19V probably damaging Het
Arid4a A T 12: 71,087,512 K1196I probably damaging Het
Asic3 A T 5: 24,414,129 M140L possibly damaging Het
BC055324 T C 1: 163,971,843 probably null Het
Bfsp2 C T 9: 103,479,878 V117M possibly damaging Het
Cd244 C A 1: 171,574,155 L150M possibly damaging Het
Cd3e T C 9: 45,001,053 Y131C probably damaging Het
Clptm1l T C 13: 73,608,906 I202T probably benign Het
Cnot4 G T 6: 35,068,604 T224K probably damaging Het
Col24a1 A G 3: 145,314,380 T171A probably benign Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Dcc T A 18: 71,809,120 T309S probably benign Het
Ddx21 T C 10: 62,590,691 Y461C probably damaging Het
Dnah10 G A 5: 124,760,159 V989M probably benign Het
Dppa4 A T 16: 48,291,311 K220* probably null Het
Dysf G A 6: 84,112,190 G912S probably damaging Het
Efhb A T 17: 53,399,063 N815K probably benign Het
Eml6 T A 11: 29,785,748 L1139F probably damaging Het
Eprs T G 1: 185,370,890 I78S probably damaging Het
Fat1 C A 8: 44,950,681 S156R probably damaging Het
Frzb G A 2: 80,446,819 R8W possibly damaging Het
Guf1 T A 5: 69,558,253 D47E probably damaging Het
Haus3 A T 5: 34,167,734 F194I probably damaging Het
Hivep3 C T 4: 120,094,540 R18W probably damaging Het
Hnf1b A G 11: 83,889,094 T392A probably damaging Het
Ighg2b T C 12: 113,307,079 T144A unknown Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Jhy T C 9: 40,917,591 R340G probably damaging Het
Klra3 C G 6: 130,330,253 V144L probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Lrmp G T 6: 145,144,976 E61* probably null Het
Lrrc4 A G 6: 28,830,906 F237L possibly damaging Het
Lyst T A 13: 13,681,485 C2464S probably benign Het
Maml1 T C 11: 50,266,682 E222G probably damaging Het
Med15 C T 16: 17,671,583 probably benign Het
Naalad2 T C 9: 18,385,148 I69V probably null Het
Neb T C 2: 52,291,208 K1129R probably damaging Het
Nsun6 A T 2: 15,036,302 N159K probably benign Het
Nup153 A T 13: 46,687,065 N1022K probably benign Het
Olfr1009 A G 2: 85,722,331 K309E probably benign Het
Olfr1138 C T 2: 87,737,409 R305K probably benign Het
Olfr389 T C 11: 73,776,470 N286D probably damaging Het
Otof T A 5: 30,370,797 K1901* probably null Het
Pde1c A T 6: 56,181,700 Y136N probably damaging Het
Phc1 G T 6: 122,325,774 N263K probably damaging Het
Plxna1 A T 6: 89,319,448 D1871E probably damaging Het
Prdm6 T A 18: 53,536,679 M123K possibly damaging Het
Ranbp17 T C 11: 33,475,066 D430G probably damaging Het
Rsl24d1 C A 9: 73,114,997 T287K probably damaging Het
Scn1a G A 2: 66,337,960 R101W probably damaging Het
Scn8a A G 15: 101,040,096 D1741G probably damaging Het
Serpinb1c T C 13: 32,896,941 Q53R probably benign Het
Serpinf2 C T 11: 75,432,443 R479H probably damaging Het
Sis T A 3: 72,949,527 D448V probably damaging Het
Slc27a6 T A 18: 58,579,875 D256E probably benign Het
Slc30a8 A G 15: 52,331,574 Y243C possibly damaging Het
Slc35f5 T C 1: 125,562,610 V103A probably damaging Het
Slc44a2 T C 9: 21,320,853 probably null Het
Slc7a9 T C 7: 35,459,849 L327P probably damaging Het
Stat4 A G 1: 52,102,974 Y660C probably damaging Het
Terb1 T C 8: 104,472,756 T519A possibly damaging Het
Tonsl A T 15: 76,629,300 S1245T probably damaging Het
Ttn A T 2: 76,788,818 S16072R probably damaging Het
Ttn A T 2: 76,909,246 Y3650N probably benign Het
Uhrf1bp1 T A 17: 27,887,357 C952* probably null Het
Uso1 T C 5: 92,166,585 F117S probably damaging Het
Vmn1r211 T C 13: 22,851,609 H296R probably benign Het
Vmn2r67 G A 7: 85,152,815 P93S probably damaging Het
Xirp2 A T 2: 67,516,225 I2937F possibly damaging Het
Zc2hc1c C A 12: 85,289,672 probably null Het
Zfp12 T C 5: 143,244,464 V182A probably benign Het
Zfp473 G T 7: 44,732,794 A705D possibly damaging Het
Zfp937 G T 2: 150,239,216 G389C probably damaging Het
Zfp990 A G 4: 145,538,178 D582G probably benign Het
Other mutations in Hsd17b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Hsd17b1 APN 11 101080058 missense possibly damaging 0.74
IGL01602:Hsd17b1 APN 11 101078929 missense probably damaging 1.00
IGL01605:Hsd17b1 APN 11 101078929 missense probably damaging 1.00
IGL03121:Hsd17b1 APN 11 101080044 nonsense probably null
R2184:Hsd17b1 UTSW 11 101078531 missense probably benign 0.05
R2237:Hsd17b1 UTSW 11 101079826 missense probably damaging 1.00
R2239:Hsd17b1 UTSW 11 101078463 missense probably damaging 1.00
R2380:Hsd17b1 UTSW 11 101078463 missense probably damaging 1.00
R3777:Hsd17b1 UTSW 11 101078703 missense probably damaging 1.00
R4469:Hsd17b1 UTSW 11 101080012 missense probably benign
R5185:Hsd17b1 UTSW 11 101080198 missense possibly damaging 0.49
R7108:Hsd17b1 UTSW 11 101079209 missense not run
Predicted Primers PCR Primer
(F):5'- TGCGCTACTTCTCCACGAAC -3'
(R):5'- CCATGAAGATGCTGGCACTATTTC -3'

Sequencing Primer
(F):5'- GAACCGCTTCCTACCCCTGG -3'
(R):5'- GTGGTTGCACACATCTAAGGTCC -3'
Posted On2018-07-24