Incidental Mutation 'R6702:Cdcp2'
ID528800
Institutional Source Beutler Lab
Gene Symbol Cdcp2
Ensembl Gene ENSMUSG00000047636
Gene NameCUB domain containing protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6702 (G1)
Quality Score145.008
Status Validated
Chromosome4
Chromosomal Location107096891-107113125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107107086 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 378 (C378R)
Ref Sequence ENSEMBL: ENSMUSP00000061401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062495] [ENSMUST00000221740]
Predicted Effect probably benign
Transcript: ENSMUST00000062495
AA Change: C378R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061401
Gene: ENSMUSG00000047636
AA Change: C378R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 30 143 1.74e-42 SMART
CUB 145 255 2.37e-35 SMART
CUB 257 373 9.57e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221740
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Cdcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdcp2 APN 4 107107111 missense probably benign
IGL02041:Cdcp2 APN 4 107107189 intron probably benign
IGL03396:Cdcp2 APN 4 107107172 nonsense probably null
R0128:Cdcp2 UTSW 4 107106707 splice site probably benign
R0130:Cdcp2 UTSW 4 107106707 splice site probably benign
R0519:Cdcp2 UTSW 4 107107192 intron probably benign
R0543:Cdcp2 UTSW 4 107097676 unclassified probably null
R1376:Cdcp2 UTSW 4 107102759 missense possibly damaging 0.93
R1376:Cdcp2 UTSW 4 107102759 missense possibly damaging 0.93
R1606:Cdcp2 UTSW 4 107102513 missense probably damaging 1.00
R1866:Cdcp2 UTSW 4 107107000 missense probably damaging 0.99
R1887:Cdcp2 UTSW 4 107102702 missense probably damaging 1.00
R2944:Cdcp2 UTSW 4 107102558 missense possibly damaging 0.88
R4620:Cdcp2 UTSW 4 107106730 missense probably damaging 0.99
R4816:Cdcp2 UTSW 4 107106772 missense probably damaging 1.00
R5298:Cdcp2 UTSW 4 107106985 missense probably benign 0.01
R5646:Cdcp2 UTSW 4 107105142 missense probably damaging 1.00
R5979:Cdcp2 UTSW 4 107105281 missense probably damaging 1.00
R6062:Cdcp2 UTSW 4 107102492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGCAGCCTTTGATGGG -3'
(R):5'- TGTGCATCAGTCCTGGAAAC -3'

Sequencing Primer
(F):5'- GCCTTTGATGGGGCCAG -3'
(R):5'- TCAAATATCCAAGAGGCAGAGAGC -3'
Posted On2018-07-24