Incidental Mutation 'R6702:Slit1'
ID528842
Institutional Source Beutler Lab
Gene Symbol Slit1
Ensembl Gene ENSMUSG00000025020
Gene Nameslit guidance ligand 1
SynonymsSlil1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6702 (G1)
Quality Score202.009
Status Validated
Chromosome19
Chromosomal Location41600257-41743665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 41614870 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 931 (S931A)
Ref Sequence ENSEMBL: ENSMUSP00000129034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025993] [ENSMUST00000166496] [ENSMUST00000169141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025993
AA Change: S931A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025993
Gene: ENSMUSG00000025020
AA Change: S931A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
CT 1462 1531 3.15e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166496
AA Change: S931A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128381
Gene: ENSMUSG00000025020
AA Change: S931A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
low complexity region 1437 1458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169141
AA Change: S931A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129034
Gene: ENSMUSG00000025020
AA Change: S931A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal interneuron numbers and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Atg7 C A 6: 114,671,097 probably null Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Slit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Slit1 APN 19 41650835 missense probably damaging 1.00
IGL00515:Slit1 APN 19 41624501 missense probably damaging 0.97
IGL00909:Slit1 APN 19 41602255 missense possibly damaging 0.89
IGL00953:Slit1 APN 19 41602300 missense probably damaging 1.00
IGL01116:Slit1 APN 19 41606385 missense possibly damaging 0.93
IGL01457:Slit1 APN 19 41611044 missense probably damaging 1.00
IGL01688:Slit1 APN 19 41729106 missense probably damaging 1.00
IGL01720:Slit1 APN 19 41634214 missense probably benign 0.01
IGL01925:Slit1 APN 19 41608378 missense probably damaging 0.98
IGL02008:Slit1 APN 19 41646140 missense probably damaging 0.99
IGL02312:Slit1 APN 19 41601680 missense possibly damaging 0.66
IGL02398:Slit1 APN 19 41602237 missense probably damaging 1.00
IGL02542:Slit1 APN 19 41627248 missense probably damaging 1.00
IGL02559:Slit1 APN 19 41721085 missense probably benign 0.01
IGL02609:Slit1 APN 19 41602304 missense probably damaging 0.99
IGL02623:Slit1 APN 19 41651683 missense probably damaging 0.98
IGL02729:Slit1 APN 19 41603334 missense probably damaging 1.00
IGL03230:Slit1 APN 19 41729085 missense probably damaging 1.00
IGL03387:Slit1 APN 19 41603442 missense possibly damaging 0.57
PIT4576001:Slit1 UTSW 19 41624549 missense possibly damaging 0.52
R0366:Slit1 UTSW 19 41611031 missense probably damaging 1.00
R0432:Slit1 UTSW 19 41743293 missense probably damaging 0.98
R0496:Slit1 UTSW 19 41608311 splice site probably benign
R0722:Slit1 UTSW 19 41608435 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1488:Slit1 UTSW 19 41608385 missense probably damaging 1.00
R1615:Slit1 UTSW 19 41650671 splice site probably benign
R1694:Slit1 UTSW 19 41637592 missense possibly damaging 0.69
R1762:Slit1 UTSW 19 41603335 missense probably damaging 1.00
R1842:Slit1 UTSW 19 41721038 critical splice donor site probably null
R1844:Slit1 UTSW 19 41625573 missense probably damaging 1.00
R1940:Slit1 UTSW 19 41630776 missense probably damaging 1.00
R2087:Slit1 UTSW 19 41637483 missense probably benign 0.00
R2094:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2095:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2104:Slit1 UTSW 19 41602247 missense possibly damaging 0.69
R2305:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2972:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2973:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2974:Slit1 UTSW 19 41611016 missense probably benign 0.03
R3159:Slit1 UTSW 19 41604373 missense probably benign
R3752:Slit1 UTSW 19 41646967 critical splice donor site probably null
R4095:Slit1 UTSW 19 41608486 intron probably benign
R4282:Slit1 UTSW 19 41614417 missense probably benign
R4417:Slit1 UTSW 19 41614469 missense probably damaging 1.00
R4607:Slit1 UTSW 19 41616793 missense probably benign 0.10
R4729:Slit1 UTSW 19 41647020 missense probably damaging 1.00
R4756:Slit1 UTSW 19 41649013 missense probably damaging 1.00
R4764:Slit1 UTSW 19 41721044 nonsense probably null
R4849:Slit1 UTSW 19 41649544 missense probably benign 0.17
R4874:Slit1 UTSW 19 41729054 critical splice donor site probably null
R5581:Slit1 UTSW 19 41616663 critical splice donor site probably null
R5699:Slit1 UTSW 19 41625520 critical splice donor site probably null
R5888:Slit1 UTSW 19 41743296 missense probably damaging 1.00
R5906:Slit1 UTSW 19 41606374 missense probably damaging 1.00
R6176:Slit1 UTSW 19 41637595 missense probably damaging 1.00
R6277:Slit1 UTSW 19 41600509 missense possibly damaging 0.81
R6860:Slit1 UTSW 19 41616715 missense probably benign 0.10
R7015:Slit1 UTSW 19 41629886 nonsense probably null
R7172:Slit1 UTSW 19 41634666 missense probably damaging 1.00
X0023:Slit1 UTSW 19 41601640 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCTACAGGTTGGTTCGC -3'
(R):5'- GGAGATATAGCACAACCGTCAC -3'

Sequencing Primer
(F):5'- ACACATCTGTTCTGAGGCAG -3'
(R):5'- AACCGTCACAGACTGGCAGTG -3'
Posted On2018-07-24