Incidental Mutation 'R6704:Mcam'
ID528860
Institutional Source Beutler Lab
Gene Symbol Mcam
Ensembl Gene ENSMUSG00000032135
Gene Namemelanoma cell adhesion molecule
SynonymsMuc18, CD146, s-gicerin, 1-gicerin, s-endo
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R6704 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44134469-44142727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44136920 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 124 (D124E)
Ref Sequence ENSEMBL: ENSMUSP00000149002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034650] [ENSMUST00000098852] [ENSMUST00000147836] [ENSMUST00000149241] [ENSMUST00000216002]
Predicted Effect probably benign
Transcript: ENSMUST00000034650
AA Change: D127E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034650
Gene: ENSMUSG00000032135
AA Change: D127E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098852
AA Change: D127E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096451
Gene: ENSMUSG00000032135
AA Change: D127E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132490
Predicted Effect probably benign
Transcript: ENSMUST00000147836
SMART Domains Protein: ENSMUSP00000117924
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
Pfam:V-set 2 97 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149241
SMART Domains Protein: ENSMUSP00000121090
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180670
Predicted Effect probably benign
Transcript: ENSMUST00000216002
AA Change: D124E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells exhibit impaired VEGF-induced angiogenesis in Matrigel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob T C 12: 8,010,379 S2921P probably damaging Het
Asxl3 G A 18: 22,517,305 A784T probably benign Het
Atm T C 9: 53,458,853 I2320V probably benign Het
Ccdc152 T A 15: 3,280,713 I227F probably damaging Het
Cd109 T C 9: 78,680,075 V675A probably benign Het
Col3a1 T C 1: 45,347,732 Y235H probably damaging Het
Dnmbp T C 19: 43,901,213 D705G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermn T C 2: 58,048,034 D189G possibly damaging Het
Evx2 C A 2: 74,656,155 A297S probably damaging Het
Fat1 T C 8: 45,024,373 F2152S probably damaging Het
Fndc1 A G 17: 7,771,810 V1018A unknown Het
Hyou1 T C 9: 44,381,134 probably null Het
Kcnma1 G A 14: 24,002,814 Q187* probably null Het
Macf1 C T 4: 123,410,762 probably benign Het
Mical3 T C 6: 121,009,800 probably benign Het
Mlxipl A T 5: 135,137,240 probably null Het
Myt1 A G 2: 181,811,212 M1V probably null Het
Nlrc3 C T 16: 3,965,081 V155I probably damaging Het
Nlrp2 A C 7: 5,325,041 L671* probably null Het
Olfr187 T C 16: 59,035,862 R292G probably damaging Het
Olfr824 T A 10: 130,126,155 K301* probably null Het
Omd A G 13: 49,589,873 D133G probably damaging Het
Pappa G A 4: 65,204,924 C832Y probably damaging Het
Pcnx3 A T 19: 5,686,487 V174E possibly damaging Het
Pfkl C T 10: 77,996,366 G297D probably damaging Het
Polr3a A G 14: 24,461,842 L882P probably damaging Het
Ptchd4 A G 17: 42,317,040 T131A probably benign Het
Rad50 T C 11: 53,698,918 N152S probably damaging Het
Ruvbl1 T A 6: 88,479,205 M147K probably benign Het
Sept4 T A 11: 87,589,030 I277N probably damaging Het
Serpini1 T C 3: 75,637,948 V337A probably damaging Het
Tmem131 A G 1: 36,796,180 V1620A possibly damaging Het
Tpr A G 1: 150,406,508 E248G possibly damaging Het
Ugt2b36 C A 5: 87,092,131 V132F probably damaging Het
Utrn T C 10: 12,745,291 E212G probably damaging Het
Zc2hc1c A T 12: 85,290,484 Q305L possibly damaging Het
Other mutations in Mcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Mcam APN 9 44140250 missense probably benign 0.01
IGL02671:Mcam APN 9 44137034 splice site probably benign
IGL02682:Mcam APN 9 44140417 missense possibly damaging 0.80
IGL03384:Mcam APN 9 44140512 unclassified probably benign
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0320:Mcam UTSW 9 44140186 missense possibly damaging 0.89
R1432:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1485:Mcam UTSW 9 44136763 missense probably damaging 1.00
R1503:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1730:Mcam UTSW 9 44134706 missense probably damaging 1.00
R1783:Mcam UTSW 9 44134706 missense probably damaging 1.00
R2146:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2150:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2215:Mcam UTSW 9 44139953 nonsense probably null
R4366:Mcam UTSW 9 44134697 missense probably damaging 1.00
R4519:Mcam UTSW 9 44141343 missense possibly damaging 0.95
R4948:Mcam UTSW 9 44136566 missense probably damaging 1.00
R5965:Mcam UTSW 9 44136628 missense probably damaging 1.00
R6955:Mcam UTSW 9 44139269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCAGATTCACAAGGAGAG -3'
(R):5'- ATTTGACCGAGTGCCTCTCAC -3'

Sequencing Primer
(F):5'- AGAGGCAGATACTGATTTTCCG -3'
(R):5'- GAGCTCTTGCCTGTCCACATG -3'
Posted On2018-07-24