Incidental Mutation 'R6705:Ctgf'
ID528904
Institutional Source Beutler Lab
Gene Symbol Ctgf
Ensembl Gene ENSMUSG00000019997
Gene Nameconnective tissue growth factor
SynonymsHcs24, Ccn2, Fisp12, hypertrophic chondrocyte-specific gene product 24
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6705 (G1)
Quality Score179.009
Status Validated
Chromosome10
Chromosomal Location24595442-24598683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24595955 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 25 (L25Q)
Ref Sequence ENSEMBL: ENSMUSP00000135212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020171] [ENSMUST00000129142] [ENSMUST00000176228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020171
AA Change: L48Q

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020171
Gene: ENSMUSG00000019997
AA Change: L48Q

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
CT 260 329 1.17e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125158
Predicted Effect probably damaging
Transcript: ENSMUST00000129142
AA Change: L25Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135212
Gene: ENSMUSG00000019997
AA Change: L25Q

DomainStartEndE-ValueType
IB 3 73 1.45e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141076
Predicted Effect probably damaging
Transcript: ENSMUST00000176228
AA Change: L48Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135147
Gene: ENSMUSG00000019997
AA Change: L48Q

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die at birth from respiratory failure due to axial skeletal defects and pulmonary hypoplasia associated with reduced cell proliferation, enhanced apoptosis and altered pneumocyte maturation. Osteogenesis is impaired due to impaired chondrogenesis and growth plate angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Ctgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ctgf APN 10 24596409 missense probably damaging 1.00
IGL02994:Ctgf APN 10 24596865 missense probably damaging 1.00
PIT4131001:Ctgf UTSW 10 24596090 missense probably damaging 0.97
R0443:Ctgf UTSW 10 24595803 splice site probably benign
R0496:Ctgf UTSW 10 24597515 missense possibly damaging 0.51
R0538:Ctgf UTSW 10 24596466 missense probably damaging 1.00
R1599:Ctgf UTSW 10 24597399 missense probably benign 0.08
R1721:Ctgf UTSW 10 24596797 missense probably damaging 1.00
R2095:Ctgf UTSW 10 24596479 missense probably benign 0.41
R2230:Ctgf UTSW 10 24596473 missense possibly damaging 0.61
R2322:Ctgf UTSW 10 24596834 missense probably damaging 1.00
R4913:Ctgf UTSW 10 24597327 missense probably damaging 1.00
R5697:Ctgf UTSW 10 24597456 missense probably benign
R7067:Ctgf UTSW 10 24596975 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GAGCGTATAAAAGCCAGCGC -3'
(R):5'- TCCAACACCAAAAGGTGAGG -3'

Sequencing Primer
(F):5'- ATCAGCCTCGCCTTGGTG -3'
(R):5'- TGAGGCCTCTGCAAAGGG -3'
Posted On2018-07-24