Incidental Mutation 'R6706:Tfap2c'
ID528931
Institutional Source Beutler Lab
Gene Symbol Tfap2c
Ensembl Gene ENSMUSG00000028640
Gene Nametranscription factor AP-2, gamma
SynonymsTcfap2c, Stra2, AP2gamma, Ap-2.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6706 (G1)
Quality Score216.009
Status Validated
Chromosome2
Chromosomal Location172549593-172558622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172557356 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 508 (M508V)
Ref Sequence ENSEMBL: ENSMUSP00000096657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030391] [ENSMUST00000099058] [ENSMUST00000170744]
Predicted Effect probably benign
Transcript: ENSMUST00000030391
AA Change: M444V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030391
Gene: ENSMUSG00000028640
AA Change: M444V

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 148 168 N/A INTRINSIC
Pfam:TF_AP-2 219 427 2.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099058
AA Change: M508V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096657
Gene: ENSMUSG00000028640
AA Change: M508V

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 118 130 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
low complexity region 212 232 N/A INTRINSIC
Pfam:TF_AP-2 285 486 2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142633
Predicted Effect probably benign
Transcript: ENSMUST00000170744
AA Change: M483V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129922
Gene: ENSMUSG00000028640
AA Change: M483V

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
Pfam:TF_AP-2 258 466 4.4e-102 PFAM
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sequence-specific DNA-binding transcription factor involved in the activation of several developmental genes. The encoded protein can act as either a homodimer or heterodimer with other family members and is induced during retinoic acid-mediated differentiation. It plays a role in the development of the eyes, face, body wall, limbs, and neural tube. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation, failure to establish a normal maternal-embryonic interface, malformed extra-embryonic tissues, and early embryonic lethality due to placental malfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Tfap2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Tfap2c APN 2 172551518 missense probably damaging 0.98
IGL02986:Tfap2c APN 2 172557251 missense probably damaging 1.00
IGL03151:Tfap2c APN 2 172557190 nonsense probably null
R0268:Tfap2c UTSW 2 172551503 missense probably benign 0.01
R0344:Tfap2c UTSW 2 172551503 missense probably benign 0.01
R1982:Tfap2c UTSW 2 172557236 missense probably damaging 0.98
R3120:Tfap2c UTSW 2 172557095 missense possibly damaging 0.96
R4038:Tfap2c UTSW 2 172556190 missense probably damaging 0.96
R4498:Tfap2c UTSW 2 172557182 nonsense probably null
R4570:Tfap2c UTSW 2 172557327 missense probably damaging 1.00
R4855:Tfap2c UTSW 2 172551518 missense probably damaging 0.98
R5061:Tfap2c UTSW 2 172552027 missense probably damaging 1.00
R5610:Tfap2c UTSW 2 172549858 missense probably benign 0.06
R7218:Tfap2c UTSW 2 172557357 missense probably benign 0.12
R7228:Tfap2c UTSW 2 172551572 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGAGCCGAACATACAAAACTG -3'
(R):5'- TCAGGATAGCATGTCCAGGG -3'

Sequencing Primer
(F):5'- AAAACTGTTTGTCTCATTTCAGCCTG -3'
(R):5'- TAGCATGTCCAGGGTTAAATGG -3'
Posted On2018-07-24