Incidental Mutation 'R6706:Adam34'
ID528950
Institutional Source Beutler Lab
Gene Symbol Adam34
Ensembl Gene ENSMUSG00000079058
Gene Namea disintegrin and metallopeptidase domain 34
Synonymstestase 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43650309-43710049 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 43651442 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 389 (K389*)
Ref Sequence ENSEMBL: ENSMUSP00000148332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110411] [ENSMUST00000212185]
Predicted Effect probably null
Transcript: ENSMUST00000110411
AA Change: K389*
SMART Domains Protein: ENSMUSP00000106041
Gene: ENSMUSG00000079058
AA Change: K389*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 159 5.9e-20 PFAM
Pfam:Reprolysin_5 205 377 1.6e-16 PFAM
Pfam:Reprolysin_4 205 393 3e-12 PFAM
Pfam:Reprolysin 207 397 9.4e-49 PFAM
Pfam:Reprolysin_2 224 389 1e-14 PFAM
Pfam:Reprolysin_3 231 352 2.7e-14 PFAM
DISIN 416 491 3.38e-40 SMART
ACR 492 628 9.18e-62 SMART
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212185
AA Change: K389*
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Adam34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Adam34 APN 8 43652190 missense possibly damaging 0.91
IGL01296:Adam34 APN 8 43651141 missense possibly damaging 0.90
IGL01369:Adam34 APN 8 43651057 missense probably benign 0.00
IGL01933:Adam34 APN 8 43651532 missense probably damaging 1.00
IGL01938:Adam34 APN 8 43651016 missense probably damaging 1.00
IGL02112:Adam34 APN 8 43651138 missense possibly damaging 0.46
IGL02182:Adam34 APN 8 43651753 missense probably benign
IGL02306:Adam34 APN 8 43650485 missense probably benign 0.44
IGL02661:Adam34 APN 8 43651535 missense probably damaging 1.00
IGL02888:Adam34 APN 8 43651573 missense probably damaging 1.00
IGL02979:Adam34 APN 8 43651371 missense probably damaging 1.00
IGL03073:Adam34 APN 8 43650903 missense probably damaging 0.99
PIT4453001:Adam34 UTSW 8 43651312 missense probably damaging 1.00
R0060:Adam34 UTSW 8 43675883 intron probably benign
R0317:Adam34 UTSW 8 43652251 missense probably benign 0.14
R0322:Adam34 UTSW 8 43651921 missense probably benign 0.00
R0427:Adam34 UTSW 8 43652456 missense probably benign 0.15
R0593:Adam34 UTSW 8 43651687 missense possibly damaging 0.87
R0837:Adam34 UTSW 8 43651500 missense probably benign 0.00
R0927:Adam34 UTSW 8 43651584 missense probably damaging 1.00
R1634:Adam34 UTSW 8 43652090 missense possibly damaging 0.81
R1653:Adam34 UTSW 8 43650645 nonsense probably null
R1826:Adam34 UTSW 8 43651342 missense probably damaging 1.00
R1873:Adam34 UTSW 8 43651806 missense probably benign 0.02
R1943:Adam34 UTSW 8 43650827 missense possibly damaging 0.48
R1943:Adam34 UTSW 8 43651815 missense probably damaging 1.00
R2147:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2150:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2206:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2207:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2268:Adam34 UTSW 8 43650610 missense probably benign 0.00
R2349:Adam34 UTSW 8 43652378 missense probably damaging 0.99
R3983:Adam34 UTSW 8 43650769 missense probably benign
R4158:Adam34 UTSW 8 43650817 missense probably damaging 1.00
R4179:Adam34 UTSW 8 43651091 missense probably benign 0.18
R5219:Adam34 UTSW 8 43651424 missense probably benign
R5398:Adam34 UTSW 8 43651241 missense probably damaging 1.00
R5611:Adam34 UTSW 8 43651712 missense probably benign 0.43
R5928:Adam34 UTSW 8 43652030 missense probably benign 0.08
R6115:Adam34 UTSW 8 43652061 missense probably benign
R6319:Adam34 UTSW 8 43651915 missense probably benign 0.01
R6384:Adam34 UTSW 8 43650799 missense probably benign 0.00
R6992:Adam34 UTSW 8 43652605 start codon destroyed probably null 1.00
R7032:Adam34 UTSW 8 43652266 missense probably damaging 1.00
R7151:Adam34 UTSW 8 43651462 missense probably benign 0.19
R7187:Adam34 UTSW 8 43652528 missense probably benign 0.02
R7223:Adam34 UTSW 8 43652004 missense probably benign 0.02
R7487:Adam34 UTSW 8 43651154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCAGGTTTGAGAACACAG -3'
(R):5'- TTAGGGTTAGCTAATGTAGGTACAG -3'

Sequencing Primer
(F):5'- TTTGAGAACACAGTCGCTGC -3'
(R):5'- CAGTTTGTTTAACTCTAAACTGTGC -3'
Posted On2018-07-24