Incidental Mutation 'R6706:Mfsd4b5'
ID528951
Institutional Source Beutler Lab
Gene Symbol Mfsd4b5
Ensembl Gene ENSMUSG00000038528
Gene Namemajor facilitator superfamily domain containing 4B5
SynonymsBC021785
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39958061-39986646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39986417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 37 (T37S)
Ref Sequence ENSEMBL: ENSMUSP00000073304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045524] [ENSMUST00000073618] [ENSMUST00000164566] [ENSMUST00000170579]
Predicted Effect probably benign
Transcript: ENSMUST00000045524
SMART Domains Protein: ENSMUSP00000040341
Gene: ENSMUSG00000038528

DomainStartEndE-ValueType
transmembrane domain 45 64 N/A INTRINSIC
transmembrane domain 71 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073618
AA Change: T37S

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073304
Gene: ENSMUSG00000038528
AA Change: T37S

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 124 141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164566
AA Change: T37S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130944
Gene: ENSMUSG00000038528
AA Change: T37S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170579
AA Change: T37S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126439
Gene: ENSMUSG00000038528
AA Change: T37S

DomainStartEndE-ValueType
Pfam:MFS_1 39 395 7.2e-15 PFAM
Pfam:TrkH 170 325 1.4e-9 PFAM
transmembrane domain 423 445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Serpinb9d T A 13: 33,196,558 N142K probably benign Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Mfsd4b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Mfsd4b5 APN 10 39970727 missense probably damaging 1.00
R1138:Mfsd4b5 UTSW 10 39975154 missense probably damaging 1.00
R1166:Mfsd4b5 UTSW 10 39970423 missense probably damaging 1.00
R1668:Mfsd4b5 UTSW 10 39973691 missense probably damaging 0.98
R1718:Mfsd4b5 UTSW 10 39975203 missense probably benign 0.09
R3977:Mfsd4b5 UTSW 10 39974708 intron probably benign
R5015:Mfsd4b5 UTSW 10 39974762 missense probably benign 0.03
R5080:Mfsd4b5 UTSW 10 39970574 missense probably damaging 1.00
R5191:Mfsd4b5 UTSW 10 39970672 missense probably damaging 1.00
R6554:Mfsd4b5 UTSW 10 39986432 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCAAGTAAGGTTTGCTGCAG -3'
(R):5'- GGAGAAGTCTTCTGGTCAGACAG -3'

Sequencing Primer
(F):5'- CTGCAGTTGGAAAATATTAGGGTC -3'
(R):5'- TCAGACAGAACAGGGGCTC -3'
Posted On2018-07-24