Incidental Mutation 'R6706:Serpinb9d'
ID528956
Institutional Source Beutler Lab
Gene Symbol Serpinb9d
Ensembl Gene ENSMUSG00000054266
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9d
SynonymsAT2, ovalbumin, Spi9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6706 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33192959-33203129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33196558 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 142 (N142K)
Ref Sequence ENSEMBL: ENSMUSP00000067710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067198]
Predicted Effect probably benign
Transcript: ENSMUST00000067198
AA Change: N142K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067710
Gene: ENSMUSG00000054266
AA Change: N142K

DomainStartEndE-ValueType
SERPIN 13 377 1.79e-167 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,651,442 K389* probably null Het
Adam6a T G 12: 113,545,266 F420V probably benign Het
Alpl T C 4: 137,746,429 T321A probably benign Het
Asxl3 A G 18: 22,453,609 D152G probably damaging Het
B4galt4 A G 16: 38,757,811 T207A probably benign Het
Bsph2 A T 7: 13,571,047 M1K probably null Het
Cacna2d1 T A 5: 16,326,340 L535Q probably damaging Het
Cacna2d3 T C 14: 29,124,685 probably null Het
Chrdl2 T C 7: 100,010,121 probably null Het
Ctdnep1 A G 11: 69,984,312 N54S probably benign Het
Dclre1a A T 19: 56,545,069 D364E probably benign Het
Dock1 A G 7: 135,133,886 I1328V possibly damaging Het
Eno4 A T 19: 58,970,680 E411D probably benign Het
Fbxl14 A G 6: 119,480,755 Y299C probably benign Het
Fhdc1 T C 3: 84,446,422 S499G probably damaging Het
Hectd4 C T 5: 121,320,084 T771I possibly damaging Het
Kansl3 A G 1: 36,344,914 probably null Het
Letm2 G A 8: 25,593,961 H85Y probably benign Het
Map3k6 A T 4: 133,250,939 K1031* probably null Het
Mfsd4b5 T A 10: 39,986,417 T37S probably benign Het
Mgam T A 6: 40,744,786 V346D probably benign Het
Myrip C T 9: 120,388,293 H98Y possibly damaging Het
Nos2 A G 11: 78,944,723 N443D possibly damaging Het
Notch2 A T 3: 98,138,430 D1637V possibly damaging Het
Olfr1260 T A 2: 89,978,585 V269E probably damaging Het
Olfr1347 G A 7: 6,488,050 R275C probably damaging Het
Pank1 C T 19: 34,812,386 G530D probably damaging Het
Pde4dip G T 3: 97,741,393 R1036S probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plin2 T C 4: 86,660,120 T247A probably benign Het
Rp1 T A 1: 4,142,664 I1067F unknown Het
Slc12a5 A G 2: 164,988,589 Y639C probably damaging Het
Tfap2c A G 2: 172,557,356 M508V probably benign Het
Tmprss11d T C 5: 86,331,103 N147S probably benign Het
Togaram1 T A 12: 65,002,609 N1273K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Uggt2 T A 14: 119,070,881 I363F probably damaging Het
Vmn2r63 T A 7: 42,928,577 D179V probably damaging Het
Other mutations in Serpinb9d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Serpinb9d APN 13 33202671 splice site probably null
IGL01610:Serpinb9d APN 13 33198002 missense probably benign 0.12
IGL01702:Serpinb9d APN 13 33203023 missense probably damaging 1.00
IGL01833:Serpinb9d APN 13 33200705 missense probably damaging 1.00
IGL02029:Serpinb9d APN 13 33196529 missense possibly damaging 0.74
IGL03013:Serpinb9d APN 13 33196538 missense probably damaging 1.00
IGL03027:Serpinb9d APN 13 33202715 nonsense probably null
IGL03056:Serpinb9d APN 13 33202753 missense probably damaging 1.00
IGL03189:Serpinb9d APN 13 33202912 missense probably damaging 1.00
IGL03206:Serpinb9d APN 13 33198031 missense possibly damaging 0.61
R0217:Serpinb9d UTSW 13 33198022 missense possibly damaging 0.79
R0370:Serpinb9d UTSW 13 33195966 missense probably damaging 1.00
R1174:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1175:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1711:Serpinb9d UTSW 13 33200748 missense probably benign 0.03
R1716:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R1874:Serpinb9d UTSW 13 33197963 splice site probably null
R2186:Serpinb9d UTSW 13 33203047 missense possibly damaging 0.82
R2497:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R4198:Serpinb9d UTSW 13 33202674 splice site probably null
R4198:Serpinb9d UTSW 13 33202965 missense probably benign 0.01
R4199:Serpinb9d UTSW 13 33202674 splice site probably null
R4584:Serpinb9d UTSW 13 33200616 missense probably damaging 1.00
R4650:Serpinb9d UTSW 13 33202853 missense probably benign 0.00
R5573:Serpinb9d UTSW 13 33196440 critical splice acceptor site probably null
R5627:Serpinb9d UTSW 13 33202693 missense probably damaging 1.00
R6336:Serpinb9d UTSW 13 33194694 missense probably damaging 1.00
R6948:Serpinb9d UTSW 13 33200723 missense possibly damaging 0.95
R7271:Serpinb9d UTSW 13 33194634 missense probably benign 0.43
R7336:Serpinb9d UTSW 13 33200719 missense probably benign 0.00
R7436:Serpinb9d UTSW 13 33195933 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTCCATGCTAATCAGAAGGTGG -3'
(R):5'- AAAGGGTCTGAGGTGAAGCTCC -3'

Sequencing Primer
(F):5'- GGTGGAAAAGCTTGCTGAC -3'
(R):5'- CTGAGGTGAAGCTCCATGAATTCC -3'
Posted On2018-07-24