Incidental Mutation 'R6707:Klhl21'
ID528972
Institutional Source Beutler Lab
Gene Symbol Klhl21
Ensembl Gene ENSMUSG00000073700
Gene Namekelch-like 21
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6707 (G1)
Quality Score173.009
Status Validated
Chromosome4
Chromosomal Location152008803-152017680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152012327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 350 (D350G)
Ref Sequence ENSEMBL: ENSMUSP00000095380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097773
AA Change: D350G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095380
Gene: ENSMUSG00000073700
AA Change: D350G

DomainStartEndE-ValueType
BTB 35 133 2.4e-27 SMART
BACK 138 239 3.93e-27 SMART
Kelch 287 334 1.08e0 SMART
Kelch 336 382 1.3e-7 SMART
Kelch 383 422 5.88e-1 SMART
Kelch 464 512 2.97e-1 SMART
Kelch 513 560 6.57e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206007
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,223,122 V1943M probably benign Het
Acss3 T C 10: 107,084,922 Y109C probably damaging Het
Actg2 C T 6: 83,513,094 W341* probably null Het
Adam29 C T 8: 55,872,100 G440R probably damaging Het
AI314180 T A 4: 58,879,101 I63L possibly damaging Het
Arfgef3 T C 10: 18,621,155 D1153G probably benign Het
Arhgef28 G T 13: 97,936,716 Q1371K probably damaging Het
Arhgef28 T C 13: 98,075,116 T120A possibly damaging Het
BC051665 A T 13: 60,784,408 D122E probably benign Het
Boc A T 16: 44,500,616 I227N possibly damaging Het
Clca3b T A 3: 144,844,527 Q219L probably benign Het
Cyp2c66 T A 19: 39,186,500 F448Y probably damaging Het
Ddx5 A G 11: 106,782,232 M489T probably benign Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Eqtn T C 4: 94,907,819 D215G probably benign Het
Evi5l A T 8: 4,206,322 T706S probably benign Het
Gtf2f1 T C 17: 57,007,770 E90G probably benign Het
Hpx A T 7: 105,595,475 S168T probably benign Het
Ipo4 C A 14: 55,628,904 V773L possibly damaging Het
Ireb2 C T 9: 54,903,961 T716I probably damaging Het
Myh13 A T 11: 67,350,260 N821I probably damaging Het
Nipbl G T 15: 8,324,559 T1698K probably benign Het
Nod2 A G 8: 88,665,189 H686R probably benign Het
Ntf3 A G 6: 126,164,728 probably null Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Olfr816 T C 10: 129,911,739 T180A probably benign Het
Parp9 A T 16: 35,947,933 H161L probably damaging Het
Pkhd1l1 A G 15: 44,529,143 N1625D probably benign Het
Rdx T C 9: 52,063,654 F30S probably damaging Het
Smo T A 6: 29,736,174 V55E probably benign Het
Sox9 C A 11: 112,782,872 N96K probably damaging Het
Spp2 T G 1: 88,417,294 probably null Het
Tex46 A G 4: 136,612,850 N82S probably benign Het
Timm22 C T 11: 76,407,325 L41F possibly damaging Het
Tmem30a A T 9: 79,774,265 Y207* probably null Het
Tmem70 T C 1: 16,677,307 V216A probably damaging Het
Tspan18 T C 2: 93,209,957 N151S probably benign Het
Vmn2r90 T C 17: 17,728,102 C537R probably damaging Het
Vps50 A G 6: 3,545,583 Y339C probably damaging Het
Zp2 C T 7: 120,133,922 G599R possibly damaging Het
Other mutations in Klhl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Klhl21 APN 4 152015360 missense probably benign 0.00
PIT4418001:Klhl21 UTSW 4 152015378 missense possibly damaging 0.94
R0417:Klhl21 UTSW 4 152015507 missense probably damaging 1.00
R1583:Klhl21 UTSW 4 152009624 missense possibly damaging 0.51
R1599:Klhl21 UTSW 4 152012300 missense probably damaging 1.00
R1889:Klhl21 UTSW 4 152015420 missense possibly damaging 0.91
R2095:Klhl21 UTSW 4 152009393 missense probably benign
R4596:Klhl21 UTSW 4 152012540 missense probably benign 0.01
R4762:Klhl21 UTSW 4 152009811 missense possibly damaging 0.94
R6905:Klhl21 UTSW 4 152009727 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTTCAGTGCCTCAGTGACAG -3'
(R):5'- AGCAGTTGTCCATGGGGTAG -3'

Sequencing Primer
(F):5'- ACAGCTTGGTGAGGTCCTCAAG -3'
(R):5'- AGGTCATGGGCTGCAGTGC -3'
Posted On2018-07-24