Incidental Mutation 'R6710:Epn1'
ID 529093
Institutional Source Beutler Lab
Gene Symbol Epn1
Ensembl Gene ENSMUSG00000035203
Gene Name epsin 1
Synonyms Ibp1
MMRRC Submission 044828-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 5083234-5101177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5100303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 472 (E472G)
Ref Sequence ENSEMBL: ENSMUSP00000146638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000208634]
AlphaFold Q80VP1
Predicted Effect probably damaging
Transcript: ENSMUST00000045277
AA Change: E471G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203
AA Change: E471G

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098845
AA Change: E471G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203
AA Change: E471G

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155436
Predicted Effect probably damaging
Transcript: ENSMUST00000208634
AA Change: E472G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epsin protein family. The encoded protein binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Loss of function of this gene is associated with reduced tumor growth and progression in certain cancer types. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,061,923 (GRCm39) E124D probably benign Het
Aph1c T C 9: 66,741,802 (GRCm39) T27A probably benign Het
Ash2l T C 8: 26,309,740 (GRCm39) I507V possibly damaging Het
Cela2a C A 4: 141,549,554 (GRCm39) A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 24,136,572 (GRCm39) probably benign Het
Drc1 A G 5: 30,520,429 (GRCm39) D590G possibly damaging Het
Erfe A G 1: 91,300,128 (GRCm39) D318G probably damaging Het
Ifnar2 T C 16: 91,190,771 (GRCm39) C227R probably damaging Het
Marchf11 A G 15: 26,387,949 (GRCm39) Y268C probably damaging Het
Muc16 A T 9: 18,553,366 (GRCm39) I4309N possibly damaging Het
Nit2 A G 16: 56,980,493 (GRCm39) V95A possibly damaging Het
Nup205 T G 6: 35,224,308 (GRCm39) I2049S probably benign Het
Or2h1 T G 17: 37,404,638 (GRCm39) I43L probably damaging Het
Or7e175 C T 9: 20,049,378 (GRCm39) A322V probably benign Het
Pcdhb17 T C 18: 37,618,452 (GRCm39) S81P probably damaging Het
Plcg2 A G 8: 118,284,086 (GRCm39) I128V probably benign Het
Sem1 C A 6: 6,578,497 (GRCm39) E20* probably null Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Tmem26 T C 10: 68,559,884 (GRCm39) L52P probably damaging Het
Utp3 T C 5: 88,703,823 (GRCm39) Y451H probably damaging Het
Vmn2r103 T A 17: 20,032,239 (GRCm39) I671N probably damaging Het
Zbtb39 T A 10: 127,579,505 (GRCm39) I693N probably damaging Het
Zfp174 A G 16: 3,665,921 (GRCm39) E62G probably damaging Het
Other mutations in Epn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Epn1 APN 7 5,098,035 (GRCm39) missense probably benign 0.19
IGL03126:Epn1 APN 7 5,098,684 (GRCm39) missense probably benign 0.01
epsilon UTSW 7 5,098,047 (GRCm39) missense probably benign
R1074:Epn1 UTSW 7 5,098,047 (GRCm39) missense probably benign
R1365:Epn1 UTSW 7 5,096,369 (GRCm39) missense probably benign 0.05
R1848:Epn1 UTSW 7 5,092,997 (GRCm39) missense probably damaging 1.00
R2041:Epn1 UTSW 7 5,086,874 (GRCm39) missense probably damaging 0.99
R2237:Epn1 UTSW 7 5,100,601 (GRCm39) missense probably damaging 0.98
R2238:Epn1 UTSW 7 5,100,601 (GRCm39) missense probably damaging 0.98
R2239:Epn1 UTSW 7 5,100,601 (GRCm39) missense probably damaging 0.98
R4255:Epn1 UTSW 7 5,100,637 (GRCm39) missense probably damaging 1.00
R4324:Epn1 UTSW 7 5,100,210 (GRCm39) missense probably benign 0.07
R4542:Epn1 UTSW 7 5,096,980 (GRCm39) missense possibly damaging 0.63
R4703:Epn1 UTSW 7 5,098,147 (GRCm39) missense probably damaging 0.99
R4740:Epn1 UTSW 7 5,093,012 (GRCm39) missense probably damaging 1.00
R4845:Epn1 UTSW 7 5,096,908 (GRCm39) missense possibly damaging 0.94
R5838:Epn1 UTSW 7 5,100,165 (GRCm39) nonsense probably null
R5952:Epn1 UTSW 7 5,096,911 (GRCm39) missense probably damaging 1.00
R6251:Epn1 UTSW 7 5,098,935 (GRCm39) missense probably damaging 1.00
R6251:Epn1 UTSW 7 5,098,925 (GRCm39) missense probably damaging 1.00
R6296:Epn1 UTSW 7 5,093,122 (GRCm39) missense probably damaging 0.98
R6937:Epn1 UTSW 7 5,092,943 (GRCm39) missense probably damaging 1.00
R7196:Epn1 UTSW 7 5,096,380 (GRCm39) missense possibly damaging 0.68
R7420:Epn1 UTSW 7 5,100,687 (GRCm39) missense possibly damaging 0.77
R7948:Epn1 UTSW 7 5,092,992 (GRCm39) nonsense probably null
R8766:Epn1 UTSW 7 5,095,860 (GRCm39) missense possibly damaging 0.63
R8843:Epn1 UTSW 7 5,096,375 (GRCm39) missense probably benign 0.36
R9059:Epn1 UTSW 7 5,098,067 (GRCm39) missense probably benign 0.00
R9315:Epn1 UTSW 7 5,096,339 (GRCm39) missense probably benign
R9376:Epn1 UTSW 7 5,086,720 (GRCm39) unclassified probably benign
R9432:Epn1 UTSW 7 5,096,369 (GRCm39) missense probably benign 0.22
X0065:Epn1 UTSW 7 5,098,092 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTCCAAGCTCAGCTCAGC -3'
(R):5'- GCTCCATGAAACTTCTACCCTG -3'

Sequencing Primer
(F):5'- GCTACTCCATCTGAGCACTG -3'
(R):5'- CCTGTAGGGACCACAGAAGAC -3'
Posted On 2018-07-24