Incidental Mutation 'R6710:1700113H08Rik'
List |< first << previous [record 85 of 18188] next >> last >|
ID529100
Institutional Source Beutler Lab
Gene Symbol 1700113H08Rik
Ensembl Gene ENSMUSG00000047129
Gene NameRIKEN cDNA 1700113H08 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R6710 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location87058045-87230589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87226061 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 124 (E124D)
Ref Sequence ENSEMBL: ENSMUSP00000130852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169849] [ENSMUST00000189456] [ENSMUST00000189775]
Predicted Effect probably benign
Transcript: ENSMUST00000169849
AA Change: E124D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000130852
Gene: ENSMUSG00000047129
AA Change: E124D

DomainStartEndE-ValueType
Pfam:DUF4607 71 325 2.1e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189456
SMART Domains Protein: ENSMUSP00000140447
Gene: ENSMUSG00000047129

DomainStartEndE-ValueType
Pfam:DUF4607 45 206 6.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189775
SMART Domains Protein: ENSMUSP00000141184
Gene: ENSMUSG00000047129

DomainStartEndE-ValueType
Pfam:DUF4607 6 160 6.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219879
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1c T C 9: 66,834,520 T27A probably benign Het
Ash2l T C 8: 25,819,712 I507V possibly damaging Het
Cela2a C A 4: 141,822,243 A74S probably damaging Het
Dcpp3 AGGCCATGCTGGCC AGGCC 17: 23,917,598 probably benign Het
Drc1 A G 5: 30,363,085 D590G possibly damaging Het
Epn1 A G 7: 5,097,304 E472G probably damaging Het
Erfe A G 1: 91,372,406 D318G probably damaging Het
Ifnar2 T C 16: 91,393,883 C227R probably damaging Het
March11 A G 15: 26,387,863 Y268C probably damaging Het
Muc16 A T 9: 18,642,070 I4309N possibly damaging Het
Nit2 A G 16: 57,160,130 V95A possibly damaging Het
Nup205 T G 6: 35,247,373 I2049S probably benign Het
Olfr869 C T 9: 20,138,082 A322V probably benign Het
Olfr91 T G 17: 37,093,746 I43L probably damaging Het
Pcdhb17 T C 18: 37,485,399 S81P probably damaging Het
Plcg2 A G 8: 117,557,347 I128V probably benign Het
Sem1 C A 6: 6,578,497 E20* probably null Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Tmem26 T C 10: 68,724,054 L52P probably damaging Het
Utp3 T C 5: 88,555,964 Y451H probably damaging Het
Vmn2r103 T A 17: 19,811,977 I671N probably damaging Het
Zbtb39 T A 10: 127,743,636 I693N probably damaging Het
Zfp174 A G 16: 3,848,057 E62G probably damaging Het
Other mutations in 1700113H08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:1700113H08Rik APN 10 87165123 missense probably damaging 1.00
IGL01764:1700113H08Rik APN 10 87074046 start codon destroyed probably benign 0.02
IGL02173:1700113H08Rik APN 10 87225892 missense possibly damaging 0.63
IGL02756:1700113H08Rik APN 10 87165108 missense probably damaging 0.99
IGL03202:1700113H08Rik APN 10 87074047 start codon destroyed probably null 0.35
IGL03393:1700113H08Rik APN 10 87074038 utr 5 prime probably benign
R0255:1700113H08Rik UTSW 10 87226045 missense probably damaging 1.00
R0409:1700113H08Rik UTSW 10 87225954 missense probably damaging 0.98
R0744:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R0833:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R1163:1700113H08Rik UTSW 10 87121422 missense probably damaging 0.99
R2128:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R2129:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R4108:1700113H08Rik UTSW 10 87225934 missense probably damaging 1.00
R5541:1700113H08Rik UTSW 10 87225946 missense probably benign 0.00
R6345:1700113H08Rik UTSW 10 87226051 missense probably benign 0.43
R6372:1700113H08Rik UTSW 10 87230226 missense possibly damaging 0.92
R6971:1700113H08Rik UTSW 10 87165041 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAATCTCTAAGTAGCTGGATCCATC -3'
(R):5'- CTCCCTTGGAGTTGACTAAGG -3'

Sequencing Primer
(F):5'- CAGGATCTATAGGAACTCATAGTCC -3'
(R):5'- ACTAAGGGATGGTTCTGAAGTG -3'
Posted On2018-07-24