Incidental Mutation 'R6712:Fcmr'
ID529162
Institutional Source Beutler Lab
Gene Symbol Fcmr
Ensembl Gene ENSMUSG00000042474
Gene NameFc fragment of IgM receptor
Synonyms1810037B05Rik, FcmuR, Faim3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6712 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130865669-130880791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130877851 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 274 (L274P)
Ref Sequence ENSEMBL: ENSMUSP00000048303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829] [ENSMUST00000121040] [ENSMUST00000187650] [ENSMUST00000191279]
Predicted Effect probably damaging
Transcript: ENSMUST00000038829
AA Change: L274P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474
AA Change: L274P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121040
SMART Domains Protein: ENSMUSP00000113064
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
IL10 76 219 1.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149355
Predicted Effect probably benign
Transcript: ENSMUST00000187650
SMART Domains Protein: ENSMUSP00000140149
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL10 37 180 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191279
SMART Domains Protein: ENSMUSP00000140821
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Blast:IL10 76 118 2e-21 BLAST
SCOP:d2ilk__ 80 119 2e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fc receptors specifically bind to the Fc region of immunoglobulins (Igs) to mediate the unique functions of each Ig class. FAIM3 encodes an Fc receptor for IgM (see MIM 147020) (Kubagawa et al., 2009 [PubMed 19858324]; Shima et al., 2010 [PubMed 20042454]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit a slight decrease in B cell numbers reduced sensitivity to Gal-induced liver damage, increased granulocyte production of ROS and increased sensitivity to infection by Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l G A 17: 32,332,888 T443M probably damaging Het
Ankmy1 A T 1: 92,870,922 V950D probably damaging Het
Cep350 T C 1: 155,858,106 K3014E possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dmxl2 A G 9: 54,411,624 Y1586H probably damaging Het
Dnah11 A T 12: 118,050,722 I2010N probably damaging Het
Dock10 T A 1: 80,536,866 M1446L probably benign Het
E430018J23Rik A T 7: 127,392,310 H168Q probably damaging Het
Foxn1 T G 11: 78,361,259 D382A probably damaging Het
Gpr179 T C 11: 97,336,167 R1721G possibly damaging Het
H2afj A G 6: 136,808,526 I63V probably benign Het
Mfsd9 T C 1: 40,786,441 probably null Het
Mis18a T C 16: 90,727,157 E39G possibly damaging Het
Mmp27 A T 9: 7,572,176 T126S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myo5a A C 9: 75,212,900 D1635A probably benign Het
Ngdn T C 14: 55,016,188 V11A probably benign Het
Nlrc4 A T 17: 74,446,836 M184K probably damaging Het
Olfr63 T G 17: 33,269,268 H181Q possibly damaging Het
Olfr672 A T 7: 104,996,418 I162K possibly damaging Het
Peli2 C A 14: 48,250,594 Q81K probably benign Het
Pfdn2 T A 1: 171,357,851 I97K probably damaging Het
Pknox1 C A 17: 31,595,316 T205K probably benign Het
Polh T C 17: 46,190,729 S179G probably benign Het
Ppp4r4 G A 12: 103,596,443 R557Q probably damaging Het
Sipa1 A T 19: 5,660,819 D54E possibly damaging Het
Tmc8 C A 11: 117,784,813 N185K probably benign Het
Tns1 C A 1: 74,079,301 E57* probably null Het
Tyro3 G A 2: 119,804,854 A209T probably null Het
Ube2f T A 1: 91,276,449 C116S possibly damaging Het
Vmn1r231 T C 17: 20,889,730 T308A possibly damaging Het
Wwc2 T A 8: 47,900,803 M99L probably benign Het
Zfp516 C T 18: 82,957,308 R544C probably damaging Het
Other mutations in Fcmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Fcmr APN 1 130875122 missense probably benign 0.06
IGL01652:Fcmr APN 1 130878507 missense probably benign 0.25
IGL02106:Fcmr APN 1 130875135 missense probably benign
IGL03270:Fcmr APN 1 130876042 missense possibly damaging 0.63
R1635:Fcmr UTSW 1 130876185 splice site probably null
R1651:Fcmr UTSW 1 130878251 missense probably benign
R1728:Fcmr UTSW 1 130875974 missense probably benign
R1728:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1729:Fcmr UTSW 1 130875974 missense probably benign
R1729:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1730:Fcmr UTSW 1 130875974 missense probably benign
R1730:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1739:Fcmr UTSW 1 130875974 missense probably benign
R1739:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1762:Fcmr UTSW 1 130875974 missense probably benign
R1762:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1783:Fcmr UTSW 1 130875974 missense probably benign
R1783:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1784:Fcmr UTSW 1 130875974 missense probably benign
R1784:Fcmr UTSW 1 130878269 missense probably benign 0.00
R1785:Fcmr UTSW 1 130875974 missense probably benign
R1785:Fcmr UTSW 1 130878269 missense probably benign 0.00
R2037:Fcmr UTSW 1 130878333 missense possibly damaging 0.61
R6111:Fcmr UTSW 1 130877829 missense probably damaging 0.96
R6217:Fcmr UTSW 1 130878323 missense probably damaging 0.96
R6538:Fcmr UTSW 1 130875025 missense possibly damaging 0.72
R6965:Fcmr UTSW 1 130875987 missense possibly damaging 0.65
X0025:Fcmr UTSW 1 130874267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGAAGGGTGAGTCTTTAAG -3'
(R):5'- GGCAATGTTGTAGCCTGGAC -3'

Sequencing Primer
(F):5'- ACTGAAGGGTGAGTCTTTAAGTTTCC -3'
(R):5'- CAATGTTGTAGCCTGGACTTAGAC -3'
Posted On2018-07-24