Incidental Mutation 'R6712:Nlrc4'
ID529188
Institutional Source Beutler Lab
Gene Symbol Nlrc4
Ensembl Gene ENSMUSG00000039193
Gene NameNLR family, CARD domain containing 4
SynonymsCard12, Ipaf, 9530011P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6712 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location74426295-74459108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74446836 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 184 (M184K)
Ref Sequence ENSEMBL: ENSMUSP00000059637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052124]
PDB Structure
Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000052124
AA Change: M184K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: M184K

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l G A 17: 32,332,888 T443M probably damaging Het
Ankmy1 A T 1: 92,870,922 V950D probably damaging Het
Cep350 T C 1: 155,858,106 K3014E possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dmxl2 A G 9: 54,411,624 Y1586H probably damaging Het
Dnah11 A T 12: 118,050,722 I2010N probably damaging Het
Dock10 T A 1: 80,536,866 M1446L probably benign Het
E430018J23Rik A T 7: 127,392,310 H168Q probably damaging Het
Fcmr T C 1: 130,877,851 L274P probably damaging Het
Foxn1 T G 11: 78,361,259 D382A probably damaging Het
Gpr179 T C 11: 97,336,167 R1721G possibly damaging Het
H2afj A G 6: 136,808,526 I63V probably benign Het
Mfsd9 T C 1: 40,786,441 probably null Het
Mis18a T C 16: 90,727,157 E39G possibly damaging Het
Mmp27 A T 9: 7,572,176 T126S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myo5a A C 9: 75,212,900 D1635A probably benign Het
Ngdn T C 14: 55,016,188 V11A probably benign Het
Olfr63 T G 17: 33,269,268 H181Q possibly damaging Het
Olfr672 A T 7: 104,996,418 I162K possibly damaging Het
Peli2 C A 14: 48,250,594 Q81K probably benign Het
Pfdn2 T A 1: 171,357,851 I97K probably damaging Het
Pknox1 C A 17: 31,595,316 T205K probably benign Het
Polh T C 17: 46,190,729 S179G probably benign Het
Ppp4r4 G A 12: 103,596,443 R557Q probably damaging Het
Sipa1 A T 19: 5,660,819 D54E possibly damaging Het
Tmc8 C A 11: 117,784,813 N185K probably benign Het
Tns1 C A 1: 74,079,301 E57* probably null Het
Tyro3 G A 2: 119,804,854 A209T probably null Het
Ube2f T A 1: 91,276,449 C116S possibly damaging Het
Vmn1r231 T C 17: 20,889,730 T308A possibly damaging Het
Wwc2 T A 8: 47,900,803 M99L probably benign Het
Zfp516 C T 18: 82,957,308 R544C probably damaging Het
Other mutations in Nlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nlrc4 APN 17 74446534 missense probably benign 0.02
IGL00427:Nlrc4 APN 17 74447092 missense probably benign
IGL00823:Nlrc4 APN 17 74447990 missense probably benign 0.01
IGL01404:Nlrc4 APN 17 74445711 missense probably damaging 1.00
IGL02178:Nlrc4 APN 17 74446843 missense probably damaging 1.00
IGL02266:Nlrc4 APN 17 74446167 missense possibly damaging 0.72
IGL03342:Nlrc4 APN 17 74445318 missense probably damaging 1.00
inwood UTSW 17 74445630 missense probably damaging 1.00
PIT4305001:Nlrc4 UTSW 17 74446309 missense probably damaging 0.99
PIT4466001:Nlrc4 UTSW 17 74427119 missense probably benign 0.01
R0077:Nlrc4 UTSW 17 74446831 missense probably damaging 1.00
R0398:Nlrc4 UTSW 17 74445920 missense probably damaging 0.99
R0639:Nlrc4 UTSW 17 74426963 missense probably benign 0.16
R1498:Nlrc4 UTSW 17 74446413 missense probably benign 0.43
R1565:Nlrc4 UTSW 17 74441931 missense probably benign 0.00
R1624:Nlrc4 UTSW 17 74445189 missense possibly damaging 0.55
R1666:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1668:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1690:Nlrc4 UTSW 17 74437523 nonsense probably null
R1723:Nlrc4 UTSW 17 74441908 missense probably damaging 1.00
R1988:Nlrc4 UTSW 17 74426943 missense probably benign 0.09
R1992:Nlrc4 UTSW 17 74445633 missense probably benign 0.04
R2141:Nlrc4 UTSW 17 74447951 splice site probably benign
R2256:Nlrc4 UTSW 17 74445630 missense probably damaging 1.00
R2897:Nlrc4 UTSW 17 74448045 missense probably benign
R3117:Nlrc4 UTSW 17 74436068 missense probably benign 0.00
R3861:Nlrc4 UTSW 17 74445621 missense probably benign 0.00
R4093:Nlrc4 UTSW 17 74445958 missense probably benign 0.20
R4212:Nlrc4 UTSW 17 74447115 missense possibly damaging 0.66
R4627:Nlrc4 UTSW 17 74446628 missense probably damaging 1.00
R4859:Nlrc4 UTSW 17 74436037 missense probably damaging 0.97
R4968:Nlrc4 UTSW 17 74446941 missense probably benign 0.20
R5133:Nlrc4 UTSW 17 74446717 missense possibly damaging 0.91
R5379:Nlrc4 UTSW 17 74448083 nonsense probably null
R6045:Nlrc4 UTSW 17 74446959 missense probably damaging 0.98
R6654:Nlrc4 UTSW 17 74445528 missense possibly damaging 0.55
R6976:Nlrc4 UTSW 17 74445939 missense probably damaging 1.00
R7030:Nlrc4 UTSW 17 74446006 missense probably damaging 1.00
R7153:Nlrc4 UTSW 17 74447103 missense possibly damaging 0.84
R7190:Nlrc4 UTSW 17 74445203 missense probably damaging 1.00
R7398:Nlrc4 UTSW 17 74446542 missense probably damaging 1.00
R7417:Nlrc4 UTSW 17 74446488 missense probably benign 0.18
R7468:Nlrc4 UTSW 17 74445512 missense probably benign 0.00
X0026:Nlrc4 UTSW 17 74446643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCTTGTGTAGCTTCAGCAG -3'
(R):5'- AACAGCCCTGCTTTTCTGAAC -3'

Sequencing Primer
(F):5'- CTTCAGCAGCAGAGCCTTGAAG -3'
(R):5'- CCCTGGGTGAAGATATCGAC -3'
Posted On2018-07-24