Incidental Mutation 'R6713:Supt20'
ID529198
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Namesuppressor of Ty 20
SynonymsFam48a, p38IP, D3Ertd300e, p38 interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6713 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54692807-54728766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54698601 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 36 (I36K)
Ref Sequence ENSEMBL: ENSMUSP00000143750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000197502] [ENSMUST00000199652] [ENSMUST00000199655] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170552
AA Change: I36K

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: I36K

DomainStartEndE-ValueType
Pfam:Spt20 63 229 6.8e-47 PFAM
low complexity region 425 441 N/A INTRINSIC
low complexity region 468 477 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197502
AA Change: I36K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: I36K

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197568
Predicted Effect possibly damaging
Transcript: ENSMUST00000199652
AA Change: I36K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751
AA Change: I36K

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 181 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199655
AA Change: I36K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751
AA Change: I36K

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 140 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199674
AA Change: I36K

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: I36K

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200024
Predicted Effect probably benign
Transcript: ENSMUST00000200439
AA Change: I36K

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: I36K

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200450
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a C T 15: 77,488,851 T229M possibly damaging Het
Cdh16 G A 8: 104,619,985 Q226* probably null Het
Cemip A T 7: 83,943,637 N1227K probably benign Het
Dusp13 A G 14: 21,748,473 V41A probably damaging Het
F3 C T 3: 121,731,674 T53I possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fyb2 T A 4: 104,990,235 M484K probably benign Het
Glb1l A T 1: 75,202,417 H253Q probably benign Het
Grm8 T C 6: 27,363,191 E775G probably damaging Het
Hipk3 C T 2: 104,446,571 V388M probably damaging Het
Ighe T C 12: 113,269,288 probably benign Het
Kif14 A G 1: 136,525,806 T1491A probably benign Het
Klre1 A G 6: 129,582,266 probably null Het
Kpna6 A T 4: 129,653,984 L257M probably damaging Het
Ldhc G A 7: 46,866,531 probably null Het
Lekr1 C A 3: 65,683,959 A39D probably benign Het
Lins1 A G 7: 66,708,482 T122A probably benign Het
Lrrc40 G A 3: 158,063,713 R516Q probably benign Het
Meis3 G T 7: 16,182,330 G72* probably null Het
Mpo A G 11: 87,795,368 T115A probably damaging Het
Mrgprb5 A G 7: 48,168,789 V66A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nags C A 11: 102,146,521 A146E probably benign Het
Nkain4 C T 2: 180,944,177 G31D probably damaging Het
Olfr1385 T G 11: 49,494,957 C141W probably damaging Het
Olfr151 A G 9: 37,730,264 C240R probably damaging Het
Olfr728 T A 14: 50,139,724 H305L probably benign Het
Olfr994 A C 2: 85,430,539 C97G probably damaging Het
Otud6b C T 4: 14,822,739 V122I probably benign Het
Ovca2 C T 11: 75,178,743 S18N possibly damaging Het
Pax2 A G 19: 44,835,477 S370G unknown Het
Pias2 G A 18: 77,065,720 probably null Het
Slc2a10 T C 2: 165,515,208 F263L probably damaging Het
Slc6a17 T G 3: 107,471,387 M660L probably benign Het
Smarcc2 A G 10: 128,487,769 probably null Het
Srcap A G 7: 127,534,917 T937A probably benign Het
Ssh2 C A 11: 77,449,433 D470E possibly damaging Het
St8sia1 A T 6: 142,829,282 probably null Het
Tor1aip2 T A 1: 156,065,409 L487Q probably damaging Het
Zfp619 G T 7: 39,537,898 K1117N probably damaging Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727651 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0383:Supt20 UTSW 3 54703149 nonsense probably null
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1075:Supt20 UTSW 3 54706941 nonsense probably null
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R5995:Supt20 UTSW 3 54709053 missense probably damaging 0.97
R6316:Supt20 UTSW 3 54727648 small insertion probably benign
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6874:Supt20 UTSW 3 54727754 intron probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
R7149:Supt20 UTSW 3 54728411 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGTAACCATGTTGAATTGGC -3'
(R):5'- GCTAGGGAATGTAACCACTCAGC -3'

Sequencing Primer
(F):5'- CCATGTTGAATTGGCATTGTACAG -3'
(R):5'- GGGAATGTAACCACTCAGCTTTACAG -3'
Posted On2018-07-24