Incidental Mutation 'R6714:Olfr775'
ID529260
Institutional Source Beutler Lab
Gene Symbol Olfr775
Ensembl Gene ENSMUSG00000096220
Gene Nameolfactory receptor 775
SynonymsMOR111-6, MOR111-7, GA_x6K02T2PULF-10936819-10937757, MOR111-7, Olfr1518
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6714 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129248412-129253924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129250940 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 135 (N135K)
Ref Sequence ENSEMBL: ENSMUSP00000150345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097163] [ENSMUST00000214109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097163
AA Change: N135K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132845
Gene: ENSMUSG00000096220
AA Change: N135K

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 9.9e-52 PFAM
Pfam:7tm_1 39 288 9.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214109
AA Change: N135K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC061237 A T 14: 44,504,182 R127S possibly damaging Het
Bub1 C A 2: 127,814,732 M463I probably benign Het
Cdh23 T C 10: 60,331,830 I1794V possibly damaging Het
Clspn C T 4: 126,565,768 T320M probably damaging Het
Coch A C 12: 51,602,737 D277A probably damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Dnah7c A T 1: 46,740,806 I3223F probably damaging Het
E2f6 G A 12: 16,819,002 V109I probably damaging Het
Edem2 A T 2: 155,728,889 probably null Het
Efcab8 A G 2: 153,789,210 K187E probably damaging Het
Fam184a T C 10: 53,698,883 N210S probably benign Het
Fam208b A T 13: 3,594,189 F143L probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,979,534 I2066V probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm9992 T G 17: 7,376,538 E124A probably benign Het
Gpc5 C T 14: 115,552,303 Q530* probably null Het
Hmcn1 A T 1: 150,704,175 I1937K probably damaging Het
Hpx G A 7: 105,595,095 R269C probably damaging Het
Ice1 T C 13: 70,615,263 probably null Het
Kbtbd4 A T 2: 90,905,839 probably null Het
Ldlrad3 T C 2: 101,952,952 T310A probably benign Het
Lrp4 G A 2: 91,476,365 S341N possibly damaging Het
Map3k3 T C 11: 106,114,222 V69A possibly damaging Het
Myh8 T C 11: 67,306,949 Y1881H probably damaging Het
Nectin4 A T 1: 171,370,650 probably benign Het
Nhsl1 G T 10: 18,524,711 V562L possibly damaging Het
Olfr729 A T 14: 50,148,214 I220K possibly damaging Het
Pcdhga7 T A 18: 37,717,277 V779E probably benign Het
Peg12 T A 7: 62,463,569 H260L unknown Het
Qrfpr A T 3: 36,180,256 M312K possibly damaging Het
Rbl2 T A 8: 91,106,787 I730N possibly damaging Het
Rbm39 G C 2: 156,161,618 L281V possibly damaging Het
Setd1b A G 5: 123,157,591 E1074G unknown Het
Sfr1 A G 19: 47,734,966 D303G probably damaging Het
Slc7a12 T C 3: 14,481,320 V175A probably benign Het
Slc8a1 A T 17: 81,408,249 L785Q probably damaging Het
Spdl1 T A 11: 34,823,003 probably null Het
Spg11 T C 2: 122,095,731 I694M probably damaging Het
Trpc1 A T 9: 95,723,273 L111Q probably damaging Het
Tti1 A G 2: 158,007,051 V756A possibly damaging Het
Usp32 A T 11: 85,026,870 I777N probably damaging Het
Zbtb8b C T 4: 129,432,983 E97K probably damaging Het
Zfhx4 A G 3: 5,241,837 D41G probably damaging Het
Zfp493 A T 13: 67,786,380 S151C probably benign Het
Zfp503 T C 14: 21,985,757 T364A probably benign Het
Zfp507 T C 7: 35,787,727 K772R probably damaging Het
Zfp804b T A 5: 6,769,239 M1275L probably benign Het
Zfp811 G A 17: 32,797,762 H434Y probably damaging Het
Other mutations in Olfr775
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Olfr775 APN 10 129250740 missense possibly damaging 0.79
IGL01310:Olfr775 APN 10 129250996 missense possibly damaging 0.85
IGL02185:Olfr775 APN 10 129251035 missense possibly damaging 0.60
IGL02887:Olfr775 APN 10 129250925 nonsense probably null
R0584:Olfr775 UTSW 10 129250948 missense probably benign 0.01
R1482:Olfr775 UTSW 10 129251143 missense possibly damaging 0.80
R1845:Olfr775 UTSW 10 129250594 missense probably benign 0.00
R2062:Olfr775 UTSW 10 129251132 nonsense probably null
R2131:Olfr775 UTSW 10 129251074 missense probably benign 0.05
R4975:Olfr775 UTSW 10 129251272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAGATTCCCAGTTAAAGACTCC -3'
(R):5'- AGCCTCGTATCTGAGCAAGAC -3'

Sequencing Primer
(F):5'- TCCCAGTTAAAGACTCCTATGTAC -3'
(R):5'- CTCGTATCTGAGCAAGACAGCTG -3'
Posted On2018-07-24