Incidental Mutation 'R6715:Osbpl7'
ID529300
Institutional Source Beutler Lab
Gene Symbol Osbpl7
Ensembl Gene ENSMUSG00000038534
Gene Nameoxysterol binding protein-like 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R6715 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97050628-97068904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97054599 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 266 (H266R)
Ref Sequence ENSEMBL: ENSMUSP00000087474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090020] [ENSMUST00000168565]
Predicted Effect probably damaging
Transcript: ENSMUST00000090020
AA Change: H266R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087474
Gene: ENSMUSG00000038534
AA Change: H266R

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 138 154 N/A INTRINSIC
PH 174 270 7.76e-11 SMART
low complexity region 533 551 N/A INTRINSIC
Pfam:Oxysterol_BP 599 947 4.6e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154084
Predicted Effect probably damaging
Transcript: ENSMUST00000168565
AA Change: H95R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126902
Gene: ENSMUSG00000038534
AA Change: H95R

DomainStartEndE-ValueType
PH 3 99 7.76e-11 SMART
Pfam:Oxysterol_BP 427 776 8.8e-140 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Two transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 G A 12: 88,459,080 R426H probably damaging Het
Arl2 G A 19: 6,137,525 R98C probably damaging Het
Atm A G 9: 53,531,648 I105T probably damaging Het
Cnnm2 G A 19: 46,853,973 G565E probably damaging Het
D430042O09Rik C T 7: 125,761,829 Q104* probably null Het
Ddx60 G A 8: 61,983,890 G958D probably benign Het
Fbxo2 T A 4: 148,165,769 M252K probably benign Het
Filip1 C A 9: 79,818,758 A860S probably benign Het
Gm11992 C A 11: 9,061,214 S218R probably damaging Het
Gnb3 A G 6: 124,837,728 L69P possibly damaging Het
Gpr18 T G 14: 121,911,977 H212P possibly damaging Het
Iqcb1 T C 16: 36,835,629 F126S probably damaging Het
Kcnh1 A G 1: 192,337,641 D425G probably benign Het
Kdm5b T A 1: 134,609,061 probably null Het
Mcm3ap C T 10: 76,489,532 T989M possibly damaging Het
Mtor T C 4: 148,538,547 C1999R probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Myof A T 19: 37,968,346 D508E probably benign Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr663 G A 7: 104,703,956 V130M possibly damaging Het
Olfr691 A T 7: 105,337,332 I128N probably damaging Het
Pear1 T C 3: 87,759,117 Y93C probably damaging Het
Pgr A G 9: 8,964,999 H881R possibly damaging Het
Rfx1 A G 8: 84,095,815 E914G possibly damaging Het
Samm50 T C 15: 84,211,058 I415T probably benign Het
Snx7 T C 3: 117,782,336 D434G possibly damaging Het
Susd4 G A 1: 182,892,037 V406M probably benign Het
Syt15 G T 14: 34,222,862 G122V probably damaging Het
Tlr5 A G 1: 182,972,659 probably benign Het
Ttc6 T C 12: 57,674,770 probably null Het
Vmn1r211 C A 13: 22,851,779 M239I probably benign Het
Vps37a G T 8: 40,540,861 probably null Het
Other mutations in Osbpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Osbpl7 APN 11 97052300 missense probably benign 0.00
IGL02041:Osbpl7 APN 11 97060508 missense probably benign 0.08
IGL02322:Osbpl7 APN 11 97056124 missense probably benign 0.18
IGL02396:Osbpl7 APN 11 97055551 missense probably damaging 1.00
IGL02441:Osbpl7 APN 11 97067702 missense probably damaging 1.00
IGL02668:Osbpl7 APN 11 97067205 missense possibly damaging 0.90
IGL03003:Osbpl7 APN 11 97050695 missense probably benign
R0377:Osbpl7 UTSW 11 97055934 missense probably damaging 0.99
R0549:Osbpl7 UTSW 11 97067542 missense probably damaging 1.00
R0848:Osbpl7 UTSW 11 97060524 missense probably damaging 1.00
R0919:Osbpl7 UTSW 11 97056101 missense possibly damaging 0.92
R1845:Osbpl7 UTSW 11 97059128 missense probably damaging 1.00
R2119:Osbpl7 UTSW 11 97056079 missense probably benign 0.02
R2418:Osbpl7 UTSW 11 97059178 missense probably benign 0.00
R2571:Osbpl7 UTSW 11 97054841 missense probably damaging 1.00
R3746:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3747:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3749:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R4590:Osbpl7 UTSW 11 97056272 missense probably damaging 1.00
R4602:Osbpl7 UTSW 11 97056269 missense possibly damaging 0.77
R4857:Osbpl7 UTSW 11 97056669 intron probably benign
R4898:Osbpl7 UTSW 11 97060150 missense probably damaging 0.98
R5160:Osbpl7 UTSW 11 97054556 missense probably damaging 1.00
R5292:Osbpl7 UTSW 11 97067953 missense probably benign 0.07
R5685:Osbpl7 UTSW 11 97060277 missense probably damaging 1.00
R5786:Osbpl7 UTSW 11 97065832 missense probably damaging 1.00
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6239:Osbpl7 UTSW 11 97052824 critical splice donor site probably null
R6920:Osbpl7 UTSW 11 97050758 missense probably damaging 0.99
X0020:Osbpl7 UTSW 11 97056559 missense probably benign 0.01
X0060:Osbpl7 UTSW 11 97060510 nonsense probably null
X0062:Osbpl7 UTSW 11 97065643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATAGGGTTTTGTGCAAACTG -3'
(R):5'- ACACTTTCTCTCGAGGTCCAAC -3'

Sequencing Primer
(F):5'- ACTGGATGGTCTAGGGAAATTCC -3'
(R):5'- GAGGTCCAACCCCAGGTAAG -3'
Posted On2018-07-24