Incidental Mutation 'R6005:Sorcs2'
ID529366
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Namesortilin-related VPS10 domain containing receptor 2
SynonymsVPS10 domain receptor protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6005 (G1)
Quality Score57.0073
Status Validated
Chromosome5
Chromosomal Location36017180-36398139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36019384 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1142 (S1142P)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: S1142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: S1142P

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Lrrfip1 T C 1: 91,114,611 V246A probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36397553 splice site probably benign
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4092:Sorcs2 UTSW 5 36025822 missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36046530 nonsense probably null
R5727:Sorcs2 UTSW 5 36031286 missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36397810 missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGGAGTTGGCCTTTCCAC -3'
(R):5'- GGGTGCCTCACTACACATTC -3'

Sequencing Primer
(F):5'- TTTCCACGGGTCTCAGAGG -3'
(R):5'- ACTGCTTGTGGAGGCAC -3'
Posted On2018-07-31