Incidental Mutation 'R6160:Lrp3'
List |< first << previous [record 37 of 67] next >> last >|
ID529371
Institutional Source Beutler Lab
Gene Symbol Lrp3
Ensembl Gene ENSMUSG00000001802
Gene Namelow density lipoprotein receptor-related protein 3
Synonyms
MMRRC Submission 044307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6160 (G1)
Quality Score58.0073
Status Validated
Chromosome7
Chromosomal Location35200027-35215498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35204123 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 245 (D245G)
Ref Sequence ENSEMBL: ENSMUSP00000113406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048]
Predicted Effect probably benign
Transcript: ENSMUST00000001854
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118444
AA Change: D245G

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802
AA Change: D245G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122409
AA Change: D266G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802
AA Change: D266G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G A 6: 149,331,507 probably null Het
4930433I11Rik T A 7: 40,993,526 S297R possibly damaging Het
5530400C23Rik A G 6: 133,294,326 E111G possibly damaging Het
8030423J24Rik T A 13: 70,883,910 S34T unknown Het
Ace3 T A 11: 105,994,732 W20R possibly damaging Het
Adgrf1 A G 17: 43,310,687 E605G probably damaging Het
Arhgap44 G A 11: 65,162,549 probably benign Het
Atm A C 9: 53,490,959 H1404Q probably benign Het
AW209491 A G 13: 14,636,721 E53G probably damaging Het
Cdt1 C T 8: 122,571,368 T366I probably benign Het
Cerk A T 15: 86,142,773 C179S probably benign Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Clip1 T C 5: 123,613,541 K726E possibly damaging Het
Dcaf12 A T 4: 41,294,043 Y365N probably damaging Het
Dennd6b A G 15: 89,188,821 L171P probably damaging Het
Dip2c G A 13: 9,533,254 V91I probably benign Het
Dlec1 A G 9: 119,143,319 I1431V probably benign Het
Egln1 T C 8: 124,948,492 D188G probably damaging Het
Enpp5 T A 17: 44,081,368 N229K possibly damaging Het
Fmo1 T G 1: 162,836,298 I221L probably benign Het
Fsip2 G A 2: 82,987,945 W4674* probably null Het
Gm12185 G A 11: 48,908,428 Q413* probably null Het
Gm5096 G A 18: 87,757,121 C256Y probably damaging Het
Gm7298 A T 6: 121,764,927 H436L probably benign Het
Gucy2c G A 6: 136,740,686 Q430* probably null Het
Hgd A G 16: 37,613,298 H134R probably damaging Het
Hoxd8 A G 2: 74,705,999 E151G probably damaging Het
Il15ra A G 2: 11,720,016 D99G probably damaging Het
Ints4 T A 7: 97,509,583 probably null Het
Itgb1 T A 8: 128,720,283 F426L possibly damaging Het
Itpr1 A C 6: 108,518,755 I2534L probably benign Het
Kcnq4 T A 4: 120,716,559 H235L probably damaging Het
Kcnt1 T A 2: 25,892,383 I178N probably damaging Het
Kidins220 A G 12: 24,997,311 D252G probably damaging Het
Krt23 A G 11: 99,485,718 I204T probably damaging Het
Lipo4 A G 19: 33,503,293 L225P probably damaging Het
Mmp16 A G 4: 18,051,857 D282G probably damaging Het
Myo1c A T 11: 75,650,742 H18L probably benign Het
Myo1f C A 17: 33,604,344 P981Q probably benign Het
Nle1 A T 11: 82,908,157 F33I probably benign Het
Nlrp4e T G 7: 23,321,306 M406R probably damaging Het
Obscn A T 11: 59,051,785 V4857E probably damaging Het
Palb2 A T 7: 122,128,420 probably null Het
Phospho1 A T 11: 95,830,624 E22V probably damaging Het
Pom121l2 C T 13: 21,983,668 S703L possibly damaging Het
Prex2 T C 1: 10,993,851 L20P probably damaging Het
Psmb7 T C 2: 38,643,381 T45A probably damaging Het
R3hdm2 T C 10: 127,484,507 I532T probably damaging Het
Rcn1 T C 2: 105,392,017 D208G probably damaging Het
Recql5 A G 11: 115,932,787 probably null Het
Rfc4 A T 16: 23,114,683 I242N probably damaging Het
Rims1 T C 1: 22,432,984 Y650C probably damaging Het
Shc2 C T 10: 79,627,019 probably null Het
Slc14a2 A T 18: 78,158,975 probably null Het
Slc6a6 A T 6: 91,740,014 probably null Het
Synj2 C A 17: 6,008,061 H275N possibly damaging Het
T A T 17: 8,441,786 T410S probably benign Het
Tarsl2 A G 7: 65,682,779 I543V probably benign Het
Tbc1d8 T A 1: 39,372,403 K1117N probably damaging Het
Tm7sf3 A T 6: 146,606,289 L425* probably null Het
Trav14-3 A G 14: 53,763,521 Y63C probably damaging Het
Tyro3 A C 2: 119,803,270 D133A probably damaging Het
Vmn1r119 T G 7: 21,011,815 H214P possibly damaging Het
Vmn2r120 G A 17: 57,509,418 P646S probably benign Het
Zbtb7c A T 18: 76,145,833 Y454F probably benign Het
Zmym2 T C 14: 56,950,309 L1144P probably damaging Het
Other mutations in Lrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Lrp3 APN 7 35206028 splice site probably benign
IGL01714:Lrp3 APN 7 35206071 unclassified probably null
IGL03033:Lrp3 APN 7 35202627 missense possibly damaging 0.61
IGL03166:Lrp3 APN 7 35202480 missense probably benign 0.00
PIT4434001:Lrp3 UTSW 7 35203995 missense probably damaging 0.99
R0416:Lrp3 UTSW 7 35202353 missense probably benign
R0733:Lrp3 UTSW 7 35202120 missense possibly damaging 0.93
R0907:Lrp3 UTSW 7 35203293 missense probably damaging 0.99
R1437:Lrp3 UTSW 7 35213170 missense probably damaging 1.00
R1591:Lrp3 UTSW 7 35202365 missense probably benign 0.03
R1625:Lrp3 UTSW 7 35203925 missense probably damaging 1.00
R1703:Lrp3 UTSW 7 35213161 missense possibly damaging 0.95
R3976:Lrp3 UTSW 7 35204105 missense probably benign 0.06
R4196:Lrp3 UTSW 7 35203410 missense probably damaging 1.00
R4679:Lrp3 UTSW 7 35203940 missense probably damaging 1.00
R5686:Lrp3 UTSW 7 35203485 missense possibly damaging 0.84
R5836:Lrp3 UTSW 7 35203322 missense probably damaging 1.00
R6342:Lrp3 UTSW 7 35202306 missense probably benign 0.01
R6364:Lrp3 UTSW 7 35203709 missense probably benign 0.03
R6415:Lrp3 UTSW 7 35204168 missense probably benign 0.00
R6502:Lrp3 UTSW 7 35203988 missense possibly damaging 0.89
R6747:Lrp3 UTSW 7 35211437 missense probably benign
R7205:Lrp3 UTSW 7 35202626 missense probably damaging 0.99
R7232:Lrp3 UTSW 7 35206052 missense probably damaging 1.00
R7522:Lrp3 UTSW 7 35204330 missense not run
Predicted Primers PCR Primer
(F):5'- ATAACCCAGTCGTAGCTCCAGC -3'
(R):5'- CCGCTGTGACAACGGTAAATG -3'

Sequencing Primer
(F):5'- GTGCAGTGAAGGTCCGA -3'
(R):5'- CTGTGACAACGGTAAATGCCTGC -3'
Posted On2018-07-31