Incidental Mutation 'R6301:Bcas2'
ID529385
Institutional Source Beutler Lab
Gene Symbol Bcas2
Ensembl Gene ENSMUSG00000005687
Gene Namebreast carcinoma amplified sequence 2
SynonymsC76366, 6430539P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103171655-103179166 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 103171871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005830] [ENSMUST00000135017] [ENSMUST00000155520] [ENSMUST00000172288] [ENSMUST00000173206]
Predicted Effect probably benign
Transcript: ENSMUST00000005830
SMART Domains Protein: ENSMUSP00000005830
Gene: ENSMUSG00000005687

DomainStartEndE-ValueType
Pfam:BCAS2 11 216 6.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135017
SMART Domains Protein: ENSMUSP00000122413
Gene: ENSMUSG00000005687

DomainStartEndE-ValueType
Pfam:BCAS2 6 77 2.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147042
Predicted Effect unknown
Transcript: ENSMUST00000155520
AA Change: S33R
SMART Domains Protein: ENSMUSP00000116250
Gene: ENSMUSG00000005687
AA Change: S33R

DomainStartEndE-ValueType
Pfam:BCAS2 6 46 9e-10 PFAM
low complexity region 52 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172288
SMART Domains Protein: ENSMUSP00000127187
Gene: ENSMUSG00000007379

DomainStartEndE-ValueType
uDENN 481 571 1.01e-25 SMART
DENN 578 762 3.36e-77 SMART
dDENN 806 873 1.15e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173037
Predicted Effect probably benign
Transcript: ENSMUST00000173206
SMART Domains Protein: ENSMUSP00000134008
Gene: ENSMUSG00000007379

DomainStartEndE-ValueType
uDENN 424 514 1.01e-25 SMART
DENN 521 705 3.36e-77 SMART
dDENN 749 816 1.15e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174060
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality. Pups of dams homozygous for a conditional allele activated in oocytes exhibit lethality of pups associated with defects in DNA damage repair and DNA replication. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Bcas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Bcas2 APN 3 103171999 missense probably damaging 1.00
IGL02557:Bcas2 APN 3 103171867 unclassified probably benign
R1911:Bcas2 UTSW 3 103171797 nonsense probably null
R2284:Bcas2 UTSW 3 103178362 missense probably damaging 1.00
R4574:Bcas2 UTSW 3 103174350 missense probably benign 0.01
R4676:Bcas2 UTSW 3 103175701 intron probably benign
R5335:Bcas2 UTSW 3 103175635 missense probably damaging 0.99
R5624:Bcas2 UTSW 3 103173261 missense probably benign
R5633:Bcas2 UTSW 3 103178424 nonsense probably null
R5723:Bcas2 UTSW 3 103177292 intron probably benign
R6051:Bcas2 UTSW 3 103174341 missense possibly damaging 0.83
R6444:Bcas2 UTSW 3 103172046 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATAATTACCAACTGCGCGTGC -3'
(R):5'- CTTCAAAGGCAGAATAATCCGGG -3'

Sequencing Primer
(F):5'- TGTGACGTCATTCCAGGC -3'
(R):5'- AATAATCCGGGGCCGTCAG -3'
Posted On2018-08-01